Heads up:
We’re moving the GATK website, docs and forum to a new platform. Read the full story and breakdown of key changes on this blog.
Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.
Attention:
We will be out of the office for a Broad Institute event from Dec 10th to Dec 11th 2019. We will be back to monitor the GATK forum on Dec 12th 2019. In the meantime we encourage you to help out other community members with their queries.
Thank you for your patience!

?insert size =1

nelsonobhknelsonobhk Member
edited May 9 in Ask the GATK team

Hello, I have a batch of 170 custom designed target capture panel of 7Mb and sequenced with Illumina. I generated unmapped BAM and followed GATK best practice, similar to the GATK GitHub page. About 30 of my samples, the Picard CollectMultipleMetrics insert size shows insert size of 1. (Details of the output is attached below) In IGV, the insert size is shown as -1 to 1. The rest of the samples are normal and the problem persists despite I repeat the pre-processing once again. May I know how to troubleshoot? Thanks a lot in advance!

## htsjdk.samtools.metrics.StringHeader
# CollectMultipleMetrics INPUT=/home/nelson/OPERATION/RedCellNGS/final_output/RBCWorkflow/1e670026-c28f-4d2c-8711-68a4e8ca19b4/call-GatherSortedBamFiles/execution/17H029354-5.bam ASSUME_SORTED=true OUTPUT=temp METRIC_ACCUMULATION_LEVEL=[LIBRARY, SAMPLE] PROGRAM=[CollectAlignmentSummaryMetrics, CollectInsertSizeMetrics, CollectSequencingArtifactMetrics, QualityScoreDistribution] REFERENCE_SEQUENCE=/home/nelson/OPERATION/RedCellNGS/ref/Homo_sapiens_assembly38.fasta    STOP_AFTER=0 INCLUDE_UNPAIRED=false VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
## htsjdk.samtools.metrics.StringHeader
# Started on: Wed May 08 23:36:41 HKT 2019

## METRICS CLASS    picard.analysis.InsertSizeMetrics
MEDIAN_INSERT_SIZE  MODE_INSERT_SIZE    MEDIAN_ABSOLUTE_DEVIATION   MIN_INSERT_SIZE MAX_INSERT_SIZE MEAN_INSERT_SIZE    STANDARD_DEVIATION  READ_PAIRS  PAIR_ORIENTATION    WIDTH_OF_10_PERCENT WIDTH_OF_20_PERCENT WIDTH_OF_30_PERCENT WIDTH_OF_40_PERCENT WIDTH_OF_50_PERCENT WIDTH_OF_60_PERCENT WIDTH_OF_70_PERCENT WIDTH_OF_80_PERCENT WIDTH_OF_90_PERCENT WIDTH_OF_95_PERCENT WIDTH_OF_99_PERCENT SAMPLE  LIBRARY READ_GROUP
1   1   0   1   162893586   1   0   1028274 TANDEM  1   1   1   1   1   1   1   1   1   1   1   17H029354-5     
1   1   0   1   162893586   1   0   1028274 TANDEM  1   1   1   1   1   1   1   1   1   1   1   17H029354-5 REDCELLNGS  

## HISTOGRAM    java.lang.Integer
insert_size 17H029354-5.tandem_count    REDCELLNGS.tandem_count
1   1020702 1020702

Post edited by bshifaw on

Answers

  • bshifawbshifaw Member, Broadie, Moderator admin

    @nelsonobhk ,

    To confirm, you ran the following command on your samples

    CollectMultipleMetrics 
    INPUT=/home/.../call-GatherSortedBamFiles/execution/17H029354-5.bam 
    ASSUME_SORTED=true 
    OUTPUT=temp 
    METRIC_ACCUMULATION_LEVEL=[LIBRARY, SAMPLE] 
    PROGRAM=[CollectAlignmentSummaryMetrics, CollectInsertSizeMetrics, CollectSequencingArtifactMetrics, QualityScoreDistribution] 
    REFERENCE_SEQUENCE=/home/.../ref/Homo_sapiens_assembly38.fasta    
    STOP_AFTER=0 
    INCLUDE_UNPAIRED=false 
    VERBOSITY=INFO 
    QUIET=false 
    VALIDATION_STRINGENCY=STRICT 
    COMPRESSION_LEVEL=5 
    MAX_RECORDS_IN_RAM=500000 
    CREATE_INDEX=false 
    CREATE_MD5_FILE=false 
    GA4GH_CLIENT_SECRETS=client_secrets.json 
    USE_JDK_DEFLATER=false 
    USE_JDK_INFLATER=false
    

    For about 30 of your samples the results from CollectMultipleMetrics incorrectly shows the MIN_INSERT_SIZE as 1 when it should be -1 ?

  • nelsonobhknelsonobhk Member

    @shifaw,
    Thanks for your help! The CollectMultipleMetrics tools shows the average insert size to be 1 but I think the problem is not with CollectMultipleMetrics but with the BAM itself. As shown earlier, IGV shows the alignment insert size ranges from 1 to -1. I am not certain what caused the problem with my BAMs. About 4/5 of my batch is ok.

  • bshifawbshifaw Member, Broadie, Moderator admin

    Hey @nelsonobhk,

    You'll probably want to check the output bam files from each tool in your workflow to identify which tool is cause this behavior.

    Also, please share the exact workflow used to obtain the results above. If you are using a wdl, feel free to attach wdl script along with your post.

  • shuangBroadshuangBroad Broad75Member, Broadie, Dev

    One strange thing I noticed in your shared IGV screen is that seems all reads are mapped to the reverse strand (also notice the read you high lighted has pair orientation of R1R2, which is atypical). I'm not sure if you are grouping reads by strand, but if not, that is also a point to dig in.

  • nelsonobhknelsonobhk Member
    edited May 20

    @bshifaw, sorry for the late reply. Please find below the wdl.

    @shuangBroad,
    Yes, they were grouped by strand, the above repeat screenshot is not grouped by read strand.

    Thanks a lot!

    Post edited by bshifaw on
  • bshifawbshifaw Member, Broadie, Moderator admin

    The CollectAggregationMetrics task is producing the insert_size_metrics file, so you'll want to run this task on the output from the SamToFastqAndBwaMemAndMba task (or if you have the output bam already, just run the command in the CollectAggregationMetrics task on the output bam) then check the insert size from the metrics file and IGV again. This will help determine if the insert_size discrepancy is caused by the original bam alignment or by other tools in the pipeline.

  • nelsonobhknelsonobhk Member

    @bshifaw, sorry for the late reply. I tried the CollectMultipleMetrics tool on the bam from SamToFastqAndBwaMemAndMba, however, the following error comes up. If I run it on the final bam, CollectMultipleMetrics could be completed but the insert_size_metrics is again of size 1. Is it possible to troubleshoot the bam? Thank you!

    $ java -jar ~/OPERATION/RedCellNGS/tools/picard/picard/picard.jar CollectMultipleMetrics \

    I=17H029354-5.aligned.unsorted.bam \
    R=~/OPERATION/RedCellNGS/ref/Homo_sapiens_assembly38.fasta \
    O=temp

    INFO 2019-05-20 20:40:27 CollectMultipleMetrics

    ********** NOTE: Picard's command line syntax is changing.


    ********** For more information, please see:
    ********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)


    ********** The command line looks like this in the new syntax:


    ********** CollectMultipleMetrics -I 17H029354-5.aligned.unsorted.bam -R /home/nelson/OPERATION/RedCellNGS/ref/Homo_sapiens_assembly38.fasta -O temp


    20:40:27.772 INFO NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/mnt/operation/RedCellNGS/tools/picard/picard/picard.jar!/com/intel/gkl/native/libgkl_compression.so
    [Mon May 20 20:40:27 HKT 2019] CollectMultipleMetrics INPUT=17H029354-5.aligned.unsorted.bam OUTPUT=temp REFERENCE_SEQUENCE=/home/nelson/OPERATION/RedCellNGS/ref/Homo_sapiens_assembly38.fasta ASSUME_SORTED=true STOP_AFTER=0 METRIC_ACCUMULATION_LEVEL=[ALL_READS] PROGRAM=[CollectAlignmentSummaryMetrics, CollectBaseDistributionByCycle, CollectInsertSizeMetrics, MeanQualityByCycle, QualityScoreDistribution] INCLUDE_UNPAIRED=false VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
    [Mon May 20 20:40:27 HKT 2019] Executing as [email protected] on Linux 4.15.0-47-generic amd64; OpenJDK 64-Bit Server VM 11.0.3+7-Ubuntu-1ubuntu218.04.1; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.26-SNAPSHOT
    WARNING 2019-05-20 20:40:28 SinglePassSamProgram File reports sort order 'unsorted', assuming it's coordinate sorted anyway.
    [Mon May 20 20:40:37 HKT 2019] picard.analysis.CollectMultipleMetrics done. Elapsed time: 0.16 minutes.
    Runtime.totalMemory()=1782579200
    To get help, see http://broadinstitute.github.io/picard/index.html#GettingHelp
    Exception in thread "main" htsjdk.samtools.SAMException: Requesting earlier reference sequence: 10 < 16
    at htsjdk.samtools.reference.ReferenceSequenceFileWalker.get(ReferenceSequenceFileWalker.java:87)
    at picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:141)
    at picard.analysis.CollectMultipleMetrics.doWork(CollectMultipleMetrics.java:563)
    at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:295)
    at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:103)
    at picard.cmdline.PicardCommandLine.main(PicardCommandLine.java:113)

  • bshifawbshifaw Member, Broadie, Moderator admin

    @nelsonobhk

    K, lets try a different approach. Check the Final Bam records for the insert size, this should be in the 9th column under thetlen field.

    If the field is not filled in CollectMultipleMetrics will not include it's in the summary.

  • nelsonobhknelsonobhk Member

    @bshifaw, thanks for the quick reply. Please find the output below, its from the output bam generated by SamToFastqAndBwaMemAndMba. It looks the the problem appeared early in the pipeline.

    Further down, you can find the insert size of another normal bam from the same batch. (HA19)

    $ samtools view 17H029354-5.aligned.unsorted.bam | cut -f 9 | sort -n | uniq -c | sort -k1nr | head -n50
    1512988 -1
    1512987 1
    12272 0
    1083 -4925
    1083 4925
    800 -3805
    800 3805
    543 -10591
    543 10591
    406 -4258
    406 4258
    384 -26827
    384 26827
    342 -29789
    342 29789
    214 -4921
    214 4921
    187 -58
    187 58
    144 -56528
    144 56528
    125 -4919
    125 4919
    114 -74
    114 74
    101 -94
    101 94
    87 -330
    87 -3448
    87 330
    87 3448
    84 -119
    84 119
    61 -172
    61 172
    57 -120585
    57 120585
    54 -28517
    54 28517
    53 -2277487
    53 2277487
    49 -156
    49 156
    47 -30
    47 30
    45 -256
    45 256
    42 -229
    42 229
    41 -183046

    $ samtools view HA19.aligned.unsorted.bam | cut -f 9 | sort -n | uniq -c | sort -k1nr | head -n50
    49325 0
    4965 227
    4948 -227
    4926 -253
    4921 253
    4889 229
    4875 -229
    4866 -247
    4864 239
    4861 247
    4858 -239
    4849 -254
    4848 254
    4847 -220
    4846 220
    4824 242
    4812 -236
    4810 236
    4805 -242
    4799 -225
    4798 250
    4797 -250
    4792 225
    4791 -211
    4791 -243
    4790 211
    4789 207
    4788 -207
    4788 249
    4785 252
    4784 243
    4783 210
    4783 216
    4783 255
    4782 -233
    4781 -210
    4778 -255
    4778 284
    4777 -216
    4777 -284
    4777 228
    4775 -252
    4774 -249
    4772 -202
    4772 -228
    4769 202
    4768 233
    4764 245
    4761 -222
    4761 -256

  • bshifawbshifaw Member, Broadie, Moderator admin
    edited May 23

    @nelsonobhk ,

    I'm gathering help from the dev team and they were also hoping you could
    share the insert size distribution and possibly a few reads from the bam file?

    Post edited by bshifaw on
  • nelsonobhknelsonobhk Member

    @bshifaw, thanks a lot! Do you want the fastq and bam files? I can upload the files to you if needed. Below is the insert size histogram and part of the bam file.

    $ samtools view 17H029354-5.bam | head -n100
    NB501576:106:HF7NKAFXY:1:11305:5886:5213 177 chr1 17316 0 150M chr16 16999 0 GGGTCTTTGTTACAGCACCAGCCAGGGGGTCCAGGAAGACATACTTCTTGTACCTACAGAGGCGACATGGGGGTCAGGCAAGCTGACACCCGCTGTCCTGAGCCCATGTTCCTCTCCCACATCATCAGGGGCACAGCGTGCACTGTGGGG ????55????+5?5?????5?????????5??????5?5??????5??5???5???55????????5??????5?5???????????5???????5????????5??????????????55??5????????5?????5??????????? MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:145
    NB501576:106:HF7NKAFXY:3:21508:10212:6641 129 chr1 27204 0 151M = 197726 170523 AACAGAGGCCAGTTTGTTAAAAACACTCAAAATTAAAGCTAGGAGTTTGGACTTGTGGCAGGAATGAAATCCTTAGACCTGTGCTGTCCAATATGGTAGCCACCAGGCACATGCAGCCACTGAGCACTTGAAATGTGGATAGTCTGAATTG ??????????????????????????????????????????5???????5???????????????????5?????5?????????????5???????5??????????????????+??55?????5????????????+?????????5 MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:2:21211:11446:14860 129 chr1 39778 0 151M chr9 39560 0 CGCCTGTAATCACAGCTACTCAAGAGGCTGAAGCAGGAGAATTGCTTGAACTCAGGAGGTGGAGGTGGCAGTGAGCCAAGATCGTGCCACTGCACTCCAGCCTCAGTGACAGAGCGAGACTCTGTCTCAAAAAATAAATAAATAAAATGTT ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:3:21608:11912:13459 65 chr1 39778 0 151M chr19 81387 0 CGCCTGTAATCACAGCTACTCAAGAGGCTGAAGCAGGAGAATTGCTTGAACTCAGGAGGTGGAGGTGGCAGTGAGCCAAGATCGTGCCACTGCACTCCAGCCTCAGTGACAGAGCGAGACTCTGTCTCAAAAAATAAATAAATAAAATGTT ????????????????????????????????????????????????????????????????????????????????5?????????????????????????5???????????????????????????????????????????5 MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:2:11305:3678:19578 113 chr1 55760 25 49S102M = 55760 1 CATGGCTGCAGTCACCATCTTGAACCTAAAGTCCTGCAGAAGACATGGACATTCAGTGATGTCTTCCTCATTGCATTTTAAGTTCAACATGAGCAGGACTTTGTCGTGTTCACCTCTATCACATCATAAATATAGCAAACAGTAAAACTAT ?????????5?5??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? SA:Z:chrX,55025983,-,49M102S,25,0; MC:Z:49S102M RG:Z:NB501576 MQ:i:25 AS:i:102
    NB501576:106:HF7NKAFXY:2:11305:3678:19578 177 chr1 55760 25 49S102M = 55760 -1 CATGGCTGCAGTCACCATCTTGAACCTAAAGTCCTGCAGAAGACATGGACATTCAGTGATGTCTTCCTCATTGCATTTTAAGTTCAACATGAGCAGGACTTTGTCGTGTTCACCTCTATCACATCATAAATATAGCAAACAGTAAAACTAT ?????????5?5??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? SA:Z:chrX,55025983,-,49M102S,25,0; MC:Z:49S102M RG:Z:NB501576 MQ:i:25 AS:i:102
    NB501576:106:HF7NKAFXY:1:11306:1947:2859 113 chr1 62412 8 150M = 62412 1 ATGATTCACGTGTTGGTTTGGGGTAGATCATTATAGGCACATGTAGGAAACAGCTTTCAGAGATGCCTTAACCGTAATTATGCATTTGTATTCTAATTTTTATTTAATGTTATTATTGATTGCATTTTTAAAGATTCTGTATTTTTTAAA ?5?????????????+5??+5????????????+?????????+??5??????????????5???????????5?5?????+??5???????????????????+????????????????????????????????????????????? MC:Z:150M RG:Z:NB501576 MQ:i:8 AS:i:150
    NB501576:106:HF7NKAFXY:1:11306:1947:2859 177 chr1 62412 8 150M = 62412 -1 ATGATTCACGTGTTGGTTTGGGGTAGATCATTATAGGCACATGTAGGAAACAGCTTTCAGAGATGCCTTAACCGTAATTATGCATTTGTATTCTAATTTTTATTTAATGTTATTATTGATTGCATTTTTAAAGATTCTGTATTTTTTAAA ?5?????????????+5??+5????????????+?????????+??5??????????????5???????????5?5?????+??5???????????????????+????????????????????????????????????????????? MC:Z:150M RG:Z:NB501576 MQ:i:8 AS:i:150
    NB501576:106:HF7NKAFXY:3:21510:5660:4277 65 chr1 100669 0 129M21S = 100669 1 CATAAAGATTTCATAAAACCAAAGCATCAGGAAATGAAAAGAGATACAGAAAGAAAAATGATGGTAAATGGGACATTAATTTACCCTTCTAATCTCTATCACAGCAAAAAGATAATTAAAAAATCTATAATCAGCTTCAATATGACTGGC ????????????????55???????????????????????5??????????????????????5?????5????????5??+??5???5??????5??5????????5???????5+5????5?5+???55?5?????55??5????5+ MC:Z:129M21S RG:Z:NB501576 MQ:i:0 AS:i:124
    NB501576:106:HF7NKAFXY:3:21510:5660:4277 129 chr1 100669 0 129M21S = 100669 -1 CATAAAGATTTCATAAAACCAAAGCATCAGGAAATGAAAAGAGATACAGAAAGAAAAATGATGGTAAATGGGACATTAATTTACCCTTCTAATCTCTATCACAGCAAAAAGATAATTAAAAAATCTATAATCAGCTTCAATATGACTGGC ????????????????55???????????????????????5??????????????????????5?????5????????5??+??5???5??????5??5????????5???????5+5????5?5+???55?5?????55??5????5+ MC:Z:129M21S RG:Z:NB501576 MQ:i:0 AS:i:124
    NB501576:106:HF7NKAFXY:4:11610:21878:8449 129 chr1 153018 0 147M4S = 753327 600310 CCATGTTGGTCAGGCTGGTCTCAAACTCTTGACCTCAAGTGGTCCATGTGCCTCAGCCTTCCAAACTGCTAGGATTACAGGAGTGCGCCACCGCACCTGGCCCCAACCACATTTTTTGAGGCTTGGAACTTTCAGCCTCACCTGCTGCACG ??????????????+?????????5??????????5???????????????+?????+???+????????????????????5?5+???5???+5??????++??5?????5??????5??????????????????5??????+??+??$ MC:Z:147M4S RG:Z:NB501576 MQ:i:0 AS:i:142
    NB501576:106:HF7NKAFXY:2:11309:15709:1918 113 chr1 158610 0 150M = 517202 358593 ATATTCCAGCACTGGGAAACTAGGGACAGTACTTGTTCTCAAGGGAAGCTTCAGCTTAGGTGGCTCTGTAAAAGAGAAATTACATCATTGAAAAATCGTCGCAGGTCAGGTGAGGTGGCTCATACCTATAATCCCAGCCCACTGGGAGAC ????????????????????????????????5???5??????????+?????+?5?????????????5????????????????5???????????5???5???????5????5????????????????????????5????????? MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:145
    NB501576:106:HF7NKAFXY:3:11606:13526:16580 113 chr1 167579 0 151M = 526175 358597 AGCCTAGCCAAGATCATGAAACCCCGTCTCTACTAAAAATACAAAAATCAGCCAGGCGTGGTGGCTGGTGCCTGTAATCCTAGCTGCTCGGGAGGCTGAGGCAGAGAACTGCTTGAACCCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCG ?5????????????????5??????+????????????????????55?????????????????5???????????????5???????????????5????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:4:21503:15196:17885 129 chr1 169493 0 107M chr11 164689 0 AAAAAATACAAAAACTAGCCGGGCATGGTGGCACATGCCTGTAATCTCAGCTACTCAGGAGGCTGAGACAGGAGAATTGTTTGAACCCAGGGGGGCAGAGGTTGCAG ?????????????????????????????????????????????????5????????5??5????????????????5???5????+???5??????????????? MC:Z:107M RG:Z:NB501576 MQ:i:0 AS:i:107
    NB501576:106:HF7NKAFXY:4:11602:18693:8904 161 chr1 175929 0 151M chr16 90126416 0 CTCATGCCTATAATCCCAGCACTTTGGGAAGCCAAGGCAGGTGGATCACTTGACGTCAGTAGTTTGAGACCAGCCCGGGCAACATGTTGTAACCCCATCTCTACTAAAAATATATTTTAAAAATTAGCTGGGCATGGTGGTGGGCACCTGT ???????????5????5??????????????????????????????????????????????5?????????????????????????????+???????????+??????????5???????5?????????????5?????????5?5 MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:3:21508:10212:6641 65 chr1 197726 0 151M = 27204 -170523 AACAGAGGCCAGTTTGTTAAAAACACTCAAAATTAAAGCTAGGAGTTTGGACTTGTGGCAGGAATGAAATCCTTAGACCTGTGCTGTCCAATATGGTAGCCACCAGGCACATGCAGCCACTGAGCACTTGAAATGTGGATAGTCTGAATTG ??????????????????????????????????????????5???????5???????????????????5?????5?????????????5???????5??????????????????+??55?????5????????????+?????????5 MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:4:21409:5434:19422 145 chr1 204229 0 112M chr15 101957142 0 TCTCTGCCCCATGTCCAAGCGTTCTCATTGTTCAATTCCCACCTGTGAGTGAGAACATGCAGTGTTTGGTTTTCTGTCTTTGTGATAGTTTGCTCAGAATGATGGTTTCCAG ???????????5???????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:112M RG:Z:NB501576 MQ:i:0 AS:i:112
    NB501576:106:HF7NKAFXY:4:21512:12043:1934 129 chr1 206383 0 79M72S chr9 35650 0 GAATGACCCACTGGAGACCTTACAGCTCTCCTGTCACCCCCAATTCCTGGCCCCGCTGCCGCCTGGGAGGAGAATGGAGGTCGGGAGCGGGCGCGTCTGAGCTCCAGTCGCGAGGGTCCGGCTCTTTGGGGGCGTGTGCCGTCTGGTGCTG ?????5??????????5??????????????????5?+++?55??5???5++++'+5?++?++55??5??5?555??5?555??55?+?55+'+?555?55+55+5?55'+?5?5555+??+55555?5555??555?++?555?55?+5+ MC:Z:79M72S RG:Z:NB501576 MQ:i:0 AS:i:59
    NB501576:106:HF7NKAFXY:4:21505:17552:17581 81 chr1 273483 0 151M chr16 90209877 0 ATGAGTTTGGTTTCACTTAGTCTCTCTAAAGAGAAAGCAAGTCGGTAGACTAATACCTAATAAAAGCAAAGCTGCCAACAATTGAAATTGCCTAGGCTGCTCTGTGTGTCCCACATGCATGGGTGTGGGTGCCAGTGTGTGTGCGTGTGTG 5?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:4:21601:22964:14859 2177 chr1 295380 0 60M91S chr2 60461686 1 TCAAAAAATAAAAAAGACACCCAATTTTCCAGCAAAAAAAATAAGTAAAAATAAATCCTGAGGTTGCACTTGTAGGGCTTCTCGCCCGTGTGGCTGCGCCGGTGCACCACCAGGTTGCTCTGAAATTTGAACGTCTTGCCGCAGAACTCGC ?????????????5???????????????????????????????????????????????????5????????????????5???????????????55????????????????????????5?????????????????????????? SA:Z:chr2,60461686,+,60S91M,60,0; MC:Z:60S91M RG:Z:NB501576 AS:i:60
    NB501576:106:HF7NKAFXY:2:21205:21520:2890 81 chr1 351102 0 151M chr16 90227553 0 CACACAGTTCTACATAGAAAACTTTATAATTAGGTGTGTGTAGGTAGGTTAGACACGCACATATGCTTCCTAGCATTGCTAATGAGGGACAAGATACAATGTGCATTCAGCAGCCACATGTAAGTTTTCCCACCATTCTGAAAGGAATCAG 5?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:1:11307:2175:20382 2161 chr1 351507 0 48M103S chr17 5558662 -1 CGTTGCATATAAATCTCCTTTGCAAAAGAATTCCAAATAACTGATGTAATAACAGGCCCAATAGGAAACGTGGGGTTGATGCCCCAAACAGGCCATGTATTCCATATGCTTCTAGCGTCTTTTCCAAATCTATGATGCAATTAGAATGTTT $55??5?+5+??????5?5?5?????????55????5???55??5???5+?5??+???????????5???5?+?5?????+?????????55???5?????????5???????????5????????????????5????5?????5??5?? SA:Z:chr17,5558662,-,49S102M,60,1; MC:Z:49S102M RG:Z:NB501576 AS:i:42
    NB501576:106:HF7NKAFXY:3:11407:14972:6203 145 chr1 441611 0 95M chr6 170649580 0 CACCAGAAAGTTTGAACTGGGTGGAGCCCACCACAACTCAGCAAGGCCACAGCAGCCAGACTGCCTCTCTAGATTTCTCCTCTCTGGGCAAGGCA ?????????????????????55??????????????????????????????????????????????????5???????5????????????? MC:Z:95M RG:Z:NB501576 MQ:i:0 AS:i:95
    NB501576:106:HF7NKAFXY:1:21303:15906:3878 113 chr1 446115 0 151M = 446115 1 AATAAATGGTGTTGGGAAAACCGGCTAGCCATATGCAGAAAACTGAAACTGGATCCCTTTCTTACACTTTACACAAAAATTAACTCACGATGTATTAAAGACTTAAACATAAGATCTAAAACCATAAAAAACCCTAGAAGAAAACCTAGGC +?????????5??????????5+5???5????????????????????????????????????????5?????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:1:21303:15906:3878 177 chr1 446115 0 151M = 446115 -1 AATAAATGGTGTTGGGAAAACCGGCTAGCCATATGCAGAAAACTGAAACTGGATCCCTTTCTTACACTTTACACAAAAATTAACTCACGATGTATTAAAGACTTAAACATAAGATCTAAAACCATAAAAAACCCTAGAAGAAAACCTAGGC +?????????5??????????5+5???5????????????????????????????????????????5?????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:2:11109:14573:20346 97 chr1 455898 0 150M chr5 181362920 0 ATTATATATTCTAAAATAGCTAGCAGAGAAAAATTATAATGTTCCCAACACAAAGAAAAGATAAATATTCGAGGTGATGAATATCCAAATTACTCTGATTTGATCATTACACATTGTATACATGTATCAAAAATATCACATGTACCCCAA ???????????????????????????????????????????5???5???????????????????????????????????????5??????????5?????????????????????+???????????????????????+????? MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:150
    NB501576:106:HF7NKAFXY:1:21312:15210:5241 113 chr1 471845 0 151M = 706823 234979 GCCTAGCAATGGCTGTTTCTGCCAGTAAGTTAACACCAGCTCCTGCATCAGACCCTGTGACCAATGATGTTTGTTTCAAAACAGCTTGCATGGACTTCTTTTTGTCTTTACATATTTTCCTTACCTCAACCTCTTGGGATGCACCTATGAT 5?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:4:21601:22964:14859 2113 chr1 474821 0 60M91S chr2 60461686 -1 TCAAAAAATAAAAAAGACACCCAATTTTCCAGCAAAAAAAATAAGTAAAAATAAATCCTGAGGTTGCACTTGTAGGGCTTCTCGCCCGTGTGGCTGCGCCGGTGCACCACCAGGTTGCTCTGAAATTTGAACGTCTTGCCGCAGAACTCGC ?????????????5???????????????????????????????????????????????????5????????????????5???????????????55????????????????????????5?????????????????????????? SA:Z:chr2,60461686,+,60S91M,60,0; MC:Z:60S91M RG:Z:NB501576 AS:i:60
    NB501576:106:HF7NKAFXY:1:11303:17925:10490 145 chr1 503439 0 151M chr16 90157482 0 CATTCCACTCCACCCGGGGCAACAAGAGTGAAACGCCATCACAAAAAAAAAAAAAAGGTATTAATTTTTACAGAGGATCAGCACAATGAGGGACACACTAGCACAAAGTAAAGACAACTCTAGAGAATACGGAACTAGCAGAGGCCAGGCA 555?5???5???55?++?+5??55555+55?5??+???5?5????5??????????????????????+??????5?5??????????????5?5??????????5???????????????????????????????+????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:126
    NB501576:106:HF7NKAFXY:2:11309:15709:1918 177 chr1 517202 0 150M = 158610 -358593 ATATTCCAGCACTGGGAAACTAGGGACAGTACTTGTTCTCAAGGGAAGCTTCAGCTTAGGTGGCTCTGTAAAAGAGAAATTACATCATTGAAAAATCGTCGCAGGTCAGGTGAGGTGGCTCATACCTATAATCCCAGCCCACTGGGAGAC ????????????????????????????????5???5??????????+?????+?5?????????????5????????????????5???????????5???5???????5????5????????????????????????5????????? MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:145
    NB501576:106:HF7NKAFXY:3:11606:13526:16580 177 chr1 526175 0 151M = 167579 -358597 AGCCTAGCCAAGATCATGAAACCCCGTCTCTACTAAAAATACAAAAATCAGCCAGGCGTGGTGGCTGGTGCCTGTAATCCTAGCTGCTCGGGAGGCTGAGGCAGAGAACTGCTTGAACCCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCG ?5????????????????5??????+????????????????????55?????????????????5???????????????5???????????????5????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:3:11504:9660:5520 113 chr1 610015 0 61S90M = 610147 133 CCCCCAGCCCAGGCGGAAGTAGCCCTATGTCGTGAGGGGCCCAGCCCGCGGTGATGTTGGTGAGGAGATGCCCAGGCCTGGCGGCCGGCGCACGCGGGTTCTCTGTGGCCAGCAGGCGGCGCTGCAGGAGAGGAGATGCCCAGGCCTGGCG +555??+5?55?+'?55?++5+555+55+5'+555+++?5555+55'+'+55?5?+55++555+5??5??????????????????????????????55????????????????5?????????????????????????????????? MC:Z:61S90M RG:Z:NB501576 MQ:i:0 AS:i:90
    NB501576:106:HF7NKAFXY:3:11504:9660:5520 177 chr1 610147 0 61S90M = 610015 -133 CCCCCAGCCCAGGCGGAAGTAGCCCTATGTCGTGAGGGGCCCAGCCCGCGGTGATGTTGGTGAGGAGATGCCCAGGCCTGGCGGCCGGCGCACGCGGGTTCTCTGTGGCCAGCAGGCGGCGCTGCAGGAGAGGAGATGCCCAGGCCTGGCG +555??+5?55?+'?55?++5+555+55+5'+555+++?5555+55'+'+55?5?+55++555+5??5??????????????????????????????55????????????????5?????????????????????????????????? MC:Z:61S90M RG:Z:NB501576 MQ:i:0 AS:i:90
    NB501576:106:HF7NKAFXY:4:11610:4109:16881 65 chr1 629113 9 128M23S = 629113 1 ATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATAACGCACTCTCCCCTGAACTCTATACATGACAGGGCATATTAGTTG ?????5?5??????????????????????5????????????????????????????????????5?5?????5???????55??????????????5??5???5?????5?????????5???5+????????????????5?????5 MC:Z:128M23S RG:Z:NB501576 MQ:i:9 AS:i:128
    NB501576:106:HF7NKAFXY:4:11610:4109:16881 129 chr1 629113 9 128M23S = 629113 -1 ATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATAACGCACTCTCCCCTGAACTCTATACATGACAGGGCATATTAGTTG ?????5?5??????????????????????5????????????????????????????????????5?5?????5???????55??????????????5??5???5?????5?????????5???5+????????????????5?????5 MC:Z:128M23S RG:Z:NB501576 MQ:i:9 AS:i:128
    NB501576:106:HF7NKAFXY:2:21206:21995:6248 65 chr1 629209 0 151M = 629209 1 ACAACATATAACGCACTCTCCCCTGAACTCTATACAACATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATGCACCTCCTATGAAAAAACTTCCTAC ???5????????????????????????5?5??????????5???????+??????++????5?5??????+????5????5????5?????????5??5?5?????5?'?????????????????????5????5??????????+?+' MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:136
    NB501576:106:HF7NKAFXY:2:21206:21995:6248 129 chr1 629209 0 151M = 629209 -1 ACAACATATAACGCACTCTCCCCTGAACTCTATACAACATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATGCACCTCCTATGAAAAAACTTCCTAC ???5????????????????????????5?5??????????5???????+??????++????5?5??????+????5????5????5?????????5??5?5?????5?'?????????????????????5????5??????????+?+' MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:136
    NB501576:106:HF7NKAFXY:4:21504:12649:18041 129 chr1 629735 0 150M chrM 4565 0 CCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCCTCGTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTTCTAATAGCTATCCTCTTCAACAATATACTCTCCGG ??????????????????????????????????????????????????????????????????????????????????????????5????????5??????????5??????????????????????????????????????? MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:150
    NB501576:106:HF7NKAFXY:2:11310:2438:13797 177 chr1 631920 0 151M chrM 6749 0 CCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATG ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:2:11306:18122:3685 65 chr1 638758 20 151M = 638758 1 GTAAAATTTTTTTAAAAAAAAAGAAGAAGAGTACCTAATGTATAGCTGTGATTTGAAGATTTAATGAGCTGGTATTATACAACGTTTAGAAGCAGTGCCTGCCAAGCAAAAGGCTCTCATCAAATACTAACGTTTAGTAAAATCCTGTCTG ?????5??????5????5???5????5?5?5??++??55???5???555??5?????????5?555?5??5???55+??+55+????????5??5?5+???++?5??????55??????55?5????5+5?'??5?5?+?5?55?5??55+ MC:Z:151M RG:Z:NB501576 MQ:i:20 AS:i:94
    NB501576:106:HF7NKAFXY:2:11306:18122:3685 129 chr1 638758 20 151M = 638758 -1 GTAAAATTTTTTTAAAAAAAAAGAAGAAGAGTACCTAATGTATAGCTGTGATTTGAAGATTTAATGAGCTGGTATTATACAACGTTTAGAAGCAGTGCCTGCCAAGCAAAAGGCTCTCATCAAATACTAACGTTTAGTAAAATCCTGTCTG ?????5??????5????5???5????5?5?5??++??55???5???555??5?????????5?555?5??5???55+??+55+????????5??5?5+???++?5??????55??????55?5????5+5?'??5?5?+?5?55?5??55+ MC:Z:151M RG:Z:NB501576 MQ:i:20 AS:i:94
    NB501576:106:HF7NKAFXY:3:11504:16048:2278 65 chr1 645654 4 119M = 645654 1 CAGATATTCTCAGCTCAGAAGAGCAATTAGCAAATTCATAAATTAAGTGCTTGCTTCCTTTTTAGTCAAATACAAACATTTGTTAAAAGATATTATTTTGCTTTACACTTTGTCTCTCA ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:119M RG:Z:NB501576 MQ:i:4 AS:i:119
    NB501576:106:HF7NKAFXY:3:11504:16048:2278 129 chr1 645654 4 119M = 645654 -1 CAGATATTCTCAGCTCAGAAGAGCAATTAGCAAATTCATAAATTAAGTGCTTGCTTCCTTTTTAGTCAAATACAAACATTTGTTAAAAGATATTATTTTGCTTTACACTTTGTCTCTCA ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:119M RG:Z:NB501576 MQ:i:4 AS:i:119
    NB501576:106:HF7NKAFXY:2:21104:13365:17492 129 chr1 651052 0 150M chr8 129026 0 TATCAATATTATTGATATCTTCCTGAAGAACATAATTCCTGCCTACCATCAACAAGCATCAATACTTTCTACCAGCTATTCTCAACCCTCATCATCGGAAGAGACAGACACTGACTGTGTCAAAGTATTAGTCCCATCATTCAGCAATTA ????????????????????????????????????????????????????????????????????????+????????????????????????????????????????????????????????????????????????????? MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:150
    NB501576:106:HF7NKAFXY:2:21209:25349:1807 65 chr1 674706 26 151M = 674706 1 AAGCTGAAGGCCTCAAAATCTGACTTCAAAACGTATTACAGGAAAAGAACAAAAGAAGGAAGAAGCGGGTAGCGGAGAAGTGCAGCAAGGGTGGAGGGAGGTGACCGAGCTGGGTCGGAGGATCAGGAGTATGGAGGGAAGACTCCTGGGT ??5????????????5????????????????????????????????????????????????5+??????+'???????????+???55????5?5??5??55+?5????55?5'5???5??????????5??5???5??+????5??5 MC:Z:151M RG:Z:NB501576 MQ:i:26 AS:i:121
    NB501576:106:HF7NKAFXY:2:21209:25349:1807 129 chr1 674706 26 151M = 674706 -1 AAGCTGAAGGCCTCAAAATCTGACTTCAAAACGTATTACAGGAAAAGAACAAAAGAAGGAAGAAGCGGGTAGCGGAGAAGTGCAGCAAGGGTGGAGGGAGGTGACCGAGCTGGGTCGGAGGATCAGGAGTATGGAGGGAAGACTCCTGGGT ??5????????????5????????????????????????????????????????????????5+??????+'???????????+???55????5?5??5??55+?5????55?5'5???5??????????5??5???5??+????5??5 MC:Z:151M RG:Z:NB501576 MQ:i:26 AS:i:121
    NB501576:106:HF7NKAFXY:1:11305:17464:17123 113 chr1 679947 22 151M = 679947 1 CATCGATGCAAAAATCCTCAATAAAATACTGGCAAACCAAATCCAGCAGCATATCAAAAGCTTGTCCACCACAATCAAGTCAGCTTCATCCCTGGGATACAAGGCTAGTTCAACATACGCAAATCAATAAACATAATTCATCATATAAATA 5?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:22 AS:i:151
    NB501576:106:HF7NKAFXY:1:11305:17464:17123 177 chr1 679947 22 151M = 679947 -1 CATCGATGCAAAAATCCTCAATAAAATACTGGCAAACCAAATCCAGCAGCATATCAAAAGCTTGTCCACCACAATCAAGTCAGCTTCATCCCTGGGATACAAGGCTAGTTCAACATACGCAAATCAATAAACATAATTCATCATATAAATA 5?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:22 AS:i:151
    NB501576:106:HF7NKAFXY:4:21408:1521:4731 113 chr1 683910 0 150M chr6 104117 0 TACTCAAAAAACTAAAACTAGAATTACTATATGATCCAGCAATCCCACTTCCTTGTATATATCCAAAGGAATTTAAGTCAATATGCTGAAGAGATATCTCCAGGCTCATGTTCATTGCAGCATTATTCACAATACCCAAATATGAAATCA ????????55??+5????+?????+??+???5????????????55?55??????5??????55?????????+?????????5+?55??????+?????5???????5?5??5?5?????????5?????5??5?5???5??5??5??? MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:150
    NB501576:106:HF7NKAFXY:4:21507:7203:17526 113 chr1 697714 0 151M chr6 117915 0 AATGCACCATCTAATGCTTCAAGTCTAATAATTATTCAATTCCTCCAGAGCCACCAATCCAATGGTTCTACCATATTTATGCTGTCATTCACTTTACTGATATCCTTCTTACCTTACCTCTTTTCCCACTTTATATTCCATGATCAATACC ?????????????????????????????????????????????????????????????????5????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:4:21507:6318:10639 81 chr1 702404 0 151M chr5 181351373 0 GTGTGTTAATATTGTAGAAGTATTCCTAATTATGATTTCTTTGTATTCCTAATTGTAATAGCTTTGTATTTGAAAAATTATTGATTCATACTCTATATGTTATTATTTTGTATGTGATGACAACAGAATATATTATCATGCTCCTTTTGTG 5??????????????????????????????????????????????????????????????????????????????5????????????????????????????5????????????????5????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:1:21312:15210:5241 177 chr1 706823 0 151M = 471845 -234979 GCCTAGCAATGGCTGTTTCTGCCAGTAAGTTAACACCAGCTCCTGCATCAGACCCTGTGACCAATGATGTTTGTTTCAAAACAGCTTGCATGGACTTCTTTTTGTCTTTACATATTTTCCTTACCTCAACCTCTTGGGATGCACCTATGAT 5?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:0 AS:i:151
    NB501576:106:HF7NKAFXY:4:21405:4293:1991 97 chr1 748261 0 150M chr3 198206673 0 TACATTACTGGTGGGAACATAAAATTGTGTAACCATTTTGTTTGGGTATTTCTTTTCTTGTCATTTTAATTGGATTTTTAAAAAATCAAGACGGGGTTTCACTATCTTGCCCAGGCTGGTCTTGAATTCACGGGCTCAAGCCATCCTCCT ????????????????????????????????????????????????????????????????????????????????????????????'?5??????5?????????????????????????????'?55?????????????+? MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:150
    NB501576:106:HF7NKAFXY:4:11610:21878:8449 65 chr1 753327 0 147M4S = 153018 -600310 CCATGTTGGTCAGGCTGGTCTCAAACTCTTGACCTCAAGTGGTCCATGTGCCTCAGCCTTCCAAACTGCTAGGATTACAGGAGTGCGCCACCGCACCTGGCCCCAACCACATTTTTTGAGGCTTGGAACTTTCAGCCTCACCTGCTGCACG ??????????????+?????????5??????????5???????????????+?????+???+????????????????????5?5+???5???+5??????++??5?????5??????5??????????????????5??????+??+??$ MC:Z:147M4S RG:Z:NB501576 MQ:i:0 AS:i:142
    NB501576:106:HF7NKAFXY:3:21408:11043:16547 129 chr1 757123 0 150M chr19 222190 0 GACACAGATACCCCAGGCATGGTGGCTCATGCTTATAATACCAGTACTTTGGGAGGGGGTGGTGGGGGGATTGCTTGAGGCCAGGAGTTCAAGACCAGCCTAAGAAACAAAGCAAGACCTCCTCTCTAGTAAAAATAAAAAAATAAAAAT ?????????5?????5?+??????5+?????+????????+?????5???555???555????5????5?5?????5??5?5????5???5??5++???+??5???5+5??5????5?+5????5??????5??????????????5??5 MC:Z:150M RG:Z:NB501576 MQ:i:0 AS:i:145
    NB501576:106:HF7NKAFXY:1:21205:20709:12805 65 chr1 781936 30 151M = 781936 1 GGCAAATCTGGATTGGGAAAGTTGACATTAATCAACTCATTATTCCTCACAGATTTGTATTCTCCAGAGTATCCAGGTCCTTCTCAGAGAATTAAAAAGCCTGTACAGGTCTAGATATTGGTATTTTTAATTGATGATAAGCTGGAATAAT 5???????????????????????????????????????????????????????????????????????????????????????????????????5?????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:30 AS:i:151
    NB501576:106:HF7NKAFXY:1:21205:20709:12805 129 chr1 781936 30 151M = 781936 -1 GGCAAATCTGGATTGGGAAAGTTGACATTAATCAACTCATTATTCCTCACAGATTTGTATTCTCCAGAGTATCCAGGTCCTTCTCAGAGAATTAAAAAGCCTGTACAGGTCTAGATATTGGTATTTTTAATTGATGATAAGCTGGAATAAT 5???????????????????????????????????????????????????????????????????????????????????????????????????5?????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:30 AS:i:151
    NB501576:106:HF7NKAFXY:2:21206:9825:5567 129 chr1 790953 0 9S40M102S chr4 49647890 0 GAACGTAACGGAATGGAATGGAATGGAATGGAATGGAATGGAATGAAAGCAAACCGCATGACTGCCAATGGAAGTTAATGGAATGCAATGGAACCGAGTGAACGTGTAAGGAAAGAAAAGAATGGAATCATCAGGAGTGGAGGGGCGGGGG ??????????????????????????????5???55?55555?5555?5+555++'55555+?5++5?5555?555???555555+5555555++?55?555+'?55?555??555??55?555?555555555?5?5??555??++55?+ MC:Z:45M106S RG:Z:NB501576 MQ:i:0 AS:i:40
    NB501576:106:HF7NKAFXY:2:21305:25502:7940 113 chr1 791167 0 39S50M5D23M chr17 21884974 0 ATGGAATGGAATGGAATCGAATGGAATGGAGTCGAATGTAATGGATTGGAATGCAATGTACTCGAATGGAATGTACCCAAATGGAATGGTCTCGAATAGAATTGAATGGAAT ????????????????????????????????????????5?????????????????+?????????????????????5??????????????????????????????? SA:Z:chr17,21884974,-,43M5D8M10D23M38S,0,19;chrUn_KN707963v1_decoy,3012,+,112M,60,0; MC:Z:43M5D8M10D23M38S RG:Z:NB501576 MQ:i:0 AS:i:30
    NB501576:106:HF7NKAFXY:2:21305:25502:7940 2225 chr1 791167 0 39S50M5D23M = 791167 0 ATGGAATGGAATGGAATCGAATGGAATGGAGTCGAATGTAATGGATTGGAATGCAATGTACTCGAATGGAATGTACCCAAATGGAATGGTCTCGAATAGAATTGAATGGAAT ????????????????????????????????????????5?????????????????+?????????????????????5??????????????????????????????? SA:Z:chr17,21884974,-,43M5D8M10D23M38S,0,19;chrUn_KN707963v1_decoy,3012,+,112M,60,0; MC:Z:39S50M5D23M RG:Z:NB501576 AS:i:30
    NB501576:106:HF7NKAFXY:3:21602:2003:11700 113 chr1 791538 0 79S72M = 791538 1 CGGAACGGACCGGAACAACCCGACTCGAATCGACGCTACGGGAGAGTAAGGGAGGCCACTCCACTCACTCCGACTGTACTGGACTCGAATGCAAAGGAATGGAATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG $+555'+555'+555?55???5555'5555'5?'+5+5'++5555++55++5?++5555555555?5555??555++555+5555'555?+5555+?555?5?55+5??5????5???????????????????????????????????? MC:Z:79S72M RG:Z:NB501576 MQ:i:0 AS:i:57
    NB501576:106:HF7NKAFXY:3:21602:2003:11700 177 chr1 791538 0 79S72M = 791538 -1 CGGAACGGACCGGAACAACCCGACTCGAATCGACGCTACGGGAGAGTAAGGGAGGCCACTCCACTCACTCCGACTGTACTGGACTCGAATGCAAAGGAATGGAATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG $+555'+555'+555?55???5555'5555'5?'+5+5'++5555++55++5?++5555555555?5555??555++555+5555'555?+5555+?555?5?55+5??5????5???????????????????????????????????? MC:Z:79S72M RG:Z:NB501576 MQ:i:0 AS:i:57
    NB501576:106:HF7NKAFXY:1:11306:8134:16204 2177 chr1 808309 0 40M111S chr2 242116468 1 AACACACATACACCATACACACAACACACACCAATGTGTGTTGTGTGTATGGTGTATGTGTGTTGTATGTATGGTGTGTATGTATGGTTGTGCATGTATCTGTGCACACATTGGTCTGTGGGATGTATGGTGTGTGGTGGCATGTGGTATT ??????????5??????????????5???5???5??5?????????????????5????????5???????????????+????????????+???????????+5?5????????5?5????5?5????5???5?????+55?5??5+?+ SA:Z:chr2,242116468,+,34S117M,4,2; MC:Z:34S117M RG:Z:NB501576 AS:i:40
    NB501576:106:HF7NKAFXY:1:11212:7620:15730 1089 chr1 817332 60 71M = 817332 1 GAAAGGAAAGGGGAAGAATGCAAAAGTCAAAGACCCGTCACCCTCCTTGAGACAGCCCTCCCGTCCAGGCC +???????????????????????55????5???+++?555++?5??5???5????5+???+'??+????? MC:Z:71M RG:Z:NB501576 MQ:i:60 AS:i:56
    NB501576:106:HF7NKAFXY:1:11212:7620:15730 1153 chr1 817332 60 71M = 817332 -1 GAAAGGAAAGGGGAAGAATGCAAAAGTCAAAGACCCGTCACCCTCCTTGAGACAGCCCTCCCGTCCAGGCC +???????????????????????55????5???+++?555++?5??5???5????5+???+'??+????? MC:Z:71M RG:Z:NB501576 MQ:i:60 AS:i:56
    NB501576:106:HF7NKAFXY:3:11607:14738:6307 65 chr1 817332 60 71M = 817332 1 GAAAGGAAAGGGGAAGAATGCAAAAGTCAAAGACACGTCACCCTCCTTGAGACAGCCCTCCAGTCCAGGCC ?????????????????????????5???????????????5????????????????????????????? MC:Z:71M RG:Z:NB501576 MQ:i:60 AS:i:66
    NB501576:106:HF7NKAFXY:3:11607:14738:6307 129 chr1 817332 60 71M = 817332 -1 GAAAGGAAAGGGGAAGAATGCAAAAGTCAAAGACACGTCACCCTCCTTGAGACAGCCCTCCAGTCCAGGCC ?????????????????????????5???????????????5????????????????????????????? MC:Z:71M RG:Z:NB501576 MQ:i:60 AS:i:66
    NB501576:106:HF7NKAFXY:3:21502:6332:10418 65 chr1 827524 44 151M = 827524 1 ACAAAAAACGTCGCGCGAGGGGCGGGGCGCGTACGTGCAGGGAGGGGAGGCAGAGAAAAAGGCGGGGCCGGGCCGGGCCGGGGCGGGGTCTCGGGCCGGGGCGGGGAGCTTACCGACCTCCCGCCCCCGCTGCGCGCGTTTCTGGCCCTGC ?????????????????5??????????????????????????????????????????????????????????????????????????????+?????????5????+???5???5???+???+??5??????'???5????????& MC:Z:151M RG:Z:NB501576 MQ:i:44 AS:i:146
    NB501576:106:HF7NKAFXY:3:21502:6332:10418 129 chr1 827524 44 151M = 827524 -1 ACAAAAAACGTCGCGCGAGGGGCGGGGCGCGTACGTGCAGGGAGGGGAGGCAGAGAAAAAGGCGGGGCCGGGCCGGGCCGGGGCGGGGTCTCGGGCCGGGGCGGGGAGCTTACCGACCTCCCGCCCCCGCTGCGCGCGTTTCTGGCCCTGC ?????????????????5??????????????????????????????????????????????????????????????????????????????+?????????5????+???5???5???+???+??5??????'???5????????& MC:Z:151M RG:Z:NB501576 MQ:i:44 AS:i:146
    NB501576:106:HF7NKAFXY:1:21201:11170:7578 113 chr1 900174 60 151M = 900174 1 CCTGCCCCCACAGTCACCCCACATTTTAAAGGGAACTTGAGTCCATCCTGATATGTAAACGGGAGGTTAAATATCTATCATGGGGGAGAACAGACAAATCTCCAGTGCAGAATAGTTCTAAATAACCTAAGTGGAGGCTCCACTCTTGAGG 5?????5?5????????????????????5+5?????5???5??????5???????????5+?5??5??????5??????????5????5?5?????????????5??????5???55?????????????????????????5?5????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:1:21201:11170:7578 177 chr1 900174 60 151M = 900174 -1 CCTGCCCCCACAGTCACCCCACATTTTAAAGGGAACTTGAGTCCATCCTGATATGTAAACGGGAGGTTAAATATCTATCATGGGGGAGAACAGACAAATCTCCAGTGCAGAATAGTTCTAAATAACCTAAGTGGAGGCTCCACTCTTGAGG 5?????5?5????????????????????5+5?????5???5??????5???????????5+?5??5??????5??????????5????5?5?????????????5??????5???55?????????????????????????5?5????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:4:21510:16066:3377 113 chr1 904784 60 151M = 904784 1 CCACAGCTCCTCGCGCCGCCGCCTCCCGCAAACACAAAGAGCCGCGCGGCCACGACGGCCGCGTGCCCGGAGCGCCGGGGTCTTTCCTGGGCTCCAAAGTCAAGAGCTCACGTTCCGGGAGGATCTGTCCGCGGAAATTCGGTTCTGAGCG 5??????5??5'????????+????????????5?????????????????????????????5???????????????????????5????5??????5???5???5??????????????????????????????????5???????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:151
    NB501576:106:HF7NKAFXY:4:21510:16066:3377 177 chr1 904784 60 151M = 904784 -1 CCACAGCTCCTCGCGCCGCCGCCTCCCGCAAACACAAAGAGCCGCGCGGCCACGACGGCCGCGTGCCCGGAGCGCCGGGGTCTTTCCTGGGCTCCAAAGTCAAGAGCTCACGTTCCGGGAGGATCTGTCCGCGGAAATTCGGTTCTGAGCG 5??????5??5'????????+????????????5?????????????????????????????5???????????????????????5????5??????5???5???5??????????????????????????????????5???????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:151
    NB501576:106:HF7NKAFXY:2:11210:7367:1178 65 chr1 908454 60 98M53S = 908454 1 GTCTGCAAAGGGAGGAGGAGGCAAAGATACTGAAGGTGAAGAGGGAAAGGAGGAAGGGACAGGGGAGGTGACAGAGGCAGGGGAGGGGGATGAGGGGCAGGGGCGAAGGGAGGGGCGATTGGCCCTGCGAAAGGTGGGATTCTGCACACCC ?5?????????55??????????????5?+?5????5?5?5?5?????5??????????????55?5????+?5?5?+?5555555????55??555+5????+????5?55?5?+?55??5?++???'5555555?55?555?+5+5++5 MC:Z:98M53S RG:Z:NB501576 MQ:i:60 AS:i:88
    NB501576:106:HF7NKAFXY:2:11210:7367:1178 129 chr1 908454 60 98M53S = 908454 -1 GTCTGCAAAGGGAGGAGGAGGCAAAGATACTGAAGGTGAAGAGGGAAAGGAGGAAGGGACAGGGGAGGTGACAGAGGCAGGGGAGGGGGATGAGGGGCAGGGGCGAAGGGAGGGGCGATTGGCCCTGCGAAAGGTGGGATTCTGCACACCC ?5?????????55??????????????5?+?5????5?5?5?5?????5??????????????55?5????+?5?5?+?5555555????55??555+5????+????5?55?5?+?55??5?++???'5555555?55?555?+5+5++5 MC:Z:98M53S RG:Z:NB501576 MQ:i:60 AS:i:88
    NB501576:106:HF7NKAFXY:1:11106:5183:17676 113 chr1 917056 60 151M = 917056 1 AGCCAGAAGCCGAGTTCATAGGCACCCAAAGCAGCCCTGGGCCAGGGTCAGAGCTCTGTCCTTGAACCTGCCTCAGGGAAGATTCCCAACTGTCCTCAGAGCCAGGGGCACCCAGGGCTTGGGAGCTGAAGGGGGGTGGGTCTGAGACCAG 5???????????5+55???5????????????5+??????+????????5???????????????5?5???5??5??????????5??55?????????5?????????????????5???????5??????????5?????????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:151
    NB501576:106:HF7NKAFXY:1:11106:5183:17676 177 chr1 917056 60 151M = 917056 -1 AGCCAGAAGCCGAGTTCATAGGCACCCAAAGCAGCCCTGGGCCAGGGTCAGAGCTCTGTCCTTGAACCTGCCTCAGGGAAGATTCCCAACTGTCCTCAGAGCCAGGGGCACCCAGGGCTTGGGAGCTGAAGGGGGGTGGGTCTGAGACCAG 5???????????5+55???5????????????5+??????+????????5???????????????5?5???5??5??????????5??55?????????5?????????????????5???????5??????????5?????????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:151
    NB501576:106:HF7NKAFXY:2:21104:18674:4202 1089 chr1 917367 60 151M = 917367 1 GGTCTTGCCTGGGCTGGGCCCAGGGGTTCTGGCTGTGGGTTTTCTGTGCAGCACCTCGCAGTGAGCCTGACGCTGGTCCTCTCCTGCGCCCCCGTTTAATCTTATTGACCTCTCGTTACGCTACAGAGCGTAAATTCAGATTTAGAGATCT ????????????????????????????5????????????????????????????????????????5?????????????5??+?+?????5?????????????????????????????????????5?????5?5?????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:141
    NB501576:106:HF7NKAFXY:2:21104:18674:4202 1153 chr1 917367 60 151M = 917367 -1 GGTCTTGCCTGGGCTGGGCCCAGGGGTTCTGGCTGTGGGTTTTCTGTGCAGCACCTCGCAGTGAGCCTGACGCTGGTCCTCTCCTGCGCCCCCGTTTAATCTTATTGACCTCTCGTTACGCTACAGAGCGTAAATTCAGATTTAGAGATCT ????????????????????????????5????????????????????????????????????????5?????????????5??+?+?????5?????????????????????????????????????5?????5?5?????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:141
    NB501576:106:HF7NKAFXY:3:11412:3201:5935 65 chr1 917367 60 151M = 917367 1 GGTCTTGCCTGGGCTGGGCCCAGGGGTTCTGGCTGTGGGTTTTCTGTGCAGCACCTCGCAGTGAGCCTGACGCTGGTCCTCTCCTGAGCCCCCGTTTAATCTTATTGACCTCTCGTTACGCTACAGAGCGTAAATTCAGATTTAGAGATCT ??????????????????????????????????????????????????????????????????????????????????????????????????5?????????????????????????????????????????5?????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:3:11412:3201:5935 129 chr1 917367 60 151M = 917367 -1 GGTCTTGCCTGGGCTGGGCCCAGGGGTTCTGGCTGTGGGTTTTCTGTGCAGCACCTCGCAGTGAGCCTGACGCTGGTCCTCTCCTGAGCCCCCGTTTAATCTTATTGACCTCTCGTTACGCTACAGAGCGTAAATTCAGATTTAGAGATCT ??????????????????????????????????????????????????????????????????????????????????????????????????5?????????????????????????????????????????5?????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:4:11509:16321:20213 1089 chr1 917367 60 151M = 917367 1 GGTCTTGCCTGGGCTGGGCCCAGGGGTTCTGGCTGTGGGTTTTCTGTGCAGCACCTCGCAGTGAGCCTGACGCTGGTCCTCTCCTGAGCCCCCGTTTAATCTTATTGACCTCTCGTTACGCTACAGAGCGTAAATTCAGATTTAGAGATCT ????????5???5??????????????????????5?????????????5??5??5??????555???????5??5????????????????5??5????????5????????????????????????'??????????????5????5? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:4:11509:16321:20213 1153 chr1 917367 60 151M = 917367 -1 GGTCTTGCCTGGGCTGGGCCCAGGGGTTCTGGCTGTGGGTTTTCTGTGCAGCACCTCGCAGTGAGCCTGACGCTGGTCCTCTCCTGAGCCCCCGTTTAATCTTATTGACCTCTCGTTACGCTACAGAGCGTAAATTCAGATTTAGAGATCT ????????5???5??????????????????????5?????????????5??5??5??????555???????5??5????????????????5??5????????5????????????????????????'??????????????5????5? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:4:21504:11535:8363 1089 chr1 917367 60 151M = 917367 1 GGTCTTGCCTGGGCTGGGCCCAGGGGTTCTGGCTGTGGGTTTTCTGTGCAGCACCTCGCAGTGAGCCTGACGCTGGTCCTCTCCTGAGCCCCCGTTTAATCTTATTGACCTCTCGTTACGCTACAGAGCGTAAATTCAGATTTAGAGATCT ?????????????????????5?????????????????????5????????5????????????????5+???????+5??????5??????????+55???????5??5???????????????5????????????????????5??? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:4:21504:11535:8363 1153 chr1 917367 60 151M = 917367 -1 GGTCTTGCCTGGGCTGGGCCCAGGGGTTCTGGCTGTGGGTTTTCTGTGCAGCACCTCGCAGTGAGCCTGACGCTGGTCCTCTCCTGAGCCCCCGTTTAATCTTATTGACCTCTCGTTACGCTACAGAGCGTAAATTCAGATTTAGAGATCT ?????????????????????5?????????????????????5????????5????????????????5+???????+5??????5??????????+55???????5??5???????????????5????????????????????5??? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:4:21410:16506:5793 113 chr1 935769 60 151M = 935769 1 CAGCCAGGACGGCAACCTTCCCACCCTCATATCCAGCGTCCACCGCAGCCGCCACCTCGTTATGCCCGAGCATCAGAGCCGCTGTGAATTCCAGAGAGGCAGCCTGGAGATTGGCCTGCGACCCGCCGGTGAGGAGCACAGGGGGCCTGAG 5????????????????5????????????????????5?????????5??????????5?5??????????????????????5?????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:151
    NB501576:106:HF7NKAFXY:4:21410:16506:5793 177 chr1 935769 60 151M = 935769 -1 CAGCCAGGACGGCAACCTTCCCACCCTCATATCCAGCGTCCACCGCAGCCGCCACCTCGTTATGCCCGAGCATCAGAGCCGCTGTGAATTCCAGAGAGGCAGCCTGGAGATTGGCCTGCGACCCGCCGGTGAGGAGCACAGGGGGCCTGAG 5????????????????5????????????????????5?????????5??????????5?5??????????????????????5?????????????????????????????????????????????????????????????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:151
    NB501576:106:HF7NKAFXY:2:11304:4386:6800 113 chr1 976630 60 117M1D34M = 976630 1 ACAGAAGCTCACCTTCAGCCCCACGGCTGCACTCAGAGATGGCCCCGCACACGCCCGCCCCGGGAACCGCCTGCCCCCACCCCCACCAACCCCGGGAACCGCCTCCCACTCCCCCCGCAACCCCGGGAACCGCCTCCCACTCCCCCCACCA +5?55???5??5?5??????????+??????5????5?5+++??????5??????????5?????????5???5????5?????5??55????????5?????5?????????5??+?????????????????????????????????? MC:Z:117M1D34M RG:Z:NB501576 MQ:i:60 AS:i:140
    NB501576:106:HF7NKAFXY:2:11304:4386:6800 177 chr1 976630 60 117M1D34M = 976630 -1 ACAGAAGCTCACCTTCAGCCCCACGGCTGCACTCAGAGATGGCCCCGCACACGCCCGCCCCGGGAACCGCCTGCCCCCACCCCCACCAACCCCGGGAACCGCCTCCCACTCCCCCCGCAACCCCGGGAACCGCCTCCCACTCCCCCCACCA +5?55???5??5?5??????????+??????5????5?5+++??????5??????????5?????????5???5????5?????5??55????????5?????5?????????5??+?????????????????????????????????? MC:Z:117M1D34M RG:Z:NB501576 MQ:i:60 AS:i:140
    NB501576:106:HF7NKAFXY:1:11212:25309:3866 1089 chr1 983395 60 151M = 983395 1 ACTCTTGTACTGGGGAATCTTCTCCCTCTCTGCCTCCTCTTTCCACCCTCATAACGGTACCTTTCTTTGCTTGTTTGTTTGTTTGAGACGGAGTTTCACTCTTGTCGCCCCGGCTGATGTGCAATGGCAAAATCTCAGCTCACTGCAACCT ???5???????????????????????????5?????????????+?+?5??????5?????????????????????????????5??????????55??????????++'????5????+????55???????5??????5??55??+5 MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:1:11212:25309:3866 1153 chr1 983395 60 151M = 983395 -1 ACTCTTGTACTGGGGAATCTTCTCCCTCTCTGCCTCCTCTTTCCACCCTCATAACGGTACCTTTCTTTGCTTGTTTGTTTGTTTGAGACGGAGTTTCACTCTTGTCGCCCCGGCTGATGTGCAATGGCAAAATCTCAGCTCACTGCAACCT ???5???????????????????????????5?????????????+?+?5??????5?????????????????????????????5??????????55??????????++'????5????+????55???????5??????5??55??+5 MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:146
    NB501576:106:HF7NKAFXY:2:21304:11166:5238 65 chr1 983395 60 151M = 983395 1 ACTCTTGTACTGGGGAATCTTCTCCCTCTCTGCCTCCTCTTTCCACCCTCATAACGGTACCTTTCTTTGCTTGTTTGTTTGTTTGAGACGGAGTTTCACTCTTGTCGCCCAGGCTGATGTGCAATGGCAAAATCTCAGCTCACTGCAACCT ?????????+??????????????????????????????????5?+????????????????????????????????????????55?????????????????????5???????????55?????????????5????????????5 MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:151
    NB501576:106:HF7NKAFXY:2:21304:11166:5238 129 chr1 983395 60 151M = 983395 -1 ACTCTTGTACTGGGGAATCTTCTCCCTCTCTGCCTCCTCTTTCCACCCTCATAACGGTACCTTTCTTTGCTTGTTTGTTTGTTTGAGACGGAGTTTCACTCTTGTCGCCCAGGCTGATGTGCAATGGCAAAATCTCAGCTCACTGCAACCT ?????????+??????????????????????????????????5?+????????????????????????????????????????55?????????????????????5???????????55?????????????5????????????5 MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:151
    NB501576:106:HF7NKAFXY:1:21302:4641:18625 113 chr1 984012 60 151M = 984012 1 GAGGGGCCCTACCCTGAGGCCTTTTCACGACGAGCTGGCACTGGAGTTGGCCTGAGGCTTCAGGGGAAGCCCTTCCCTGTATCCAGCCCAGTCATGACCCTTCCTGGTGGGAGGGTGGCTGTAGGATGAGGAATAGTCAGGGCCCCCCTGC ??????????????5??????5?5????????5????+?????????5????5??????5????????????5????5?????????????????????????????5????????????????????????????5?????????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:141
    NB501576:106:HF7NKAFXY:1:21302:4641:18625 177 chr1 984012 60 151M = 984012 -1 GAGGGGCCCTACCCTGAGGCCTTTTCACGACGAGCTGGCACTGGAGTTGGCCTGAGGCTTCAGGGGAAGCCCTTCCCTGTATCCAGCCCAGTCATGACCCTTCCTGGTGGGAGGGTGGCTGTAGGATGAGGAATAGTCAGGGCCCCCCTGC ??????????????5??????5?5????????5????+?????????5????5??????5????????????5????5?????????????????????????????5????????????????????????????5?????????????? MC:Z:151M RG:Z:NB501576 MQ:i:60 AS:i:141
    NB501576:106:HF7NKAFXY:3:21603:14911:7468 113 chr1 993380 60 122M = 993380 1 GGAGTGCTGCTCTCACCCCTTTCCCAACAAACCAGCTTCCTGGGGACGTGCTGATGGAGCTTCCTCTTCCTAAAGCTGAACTGGAAAAACAGAAGGTGCACAACGACACGATGTCCTGGCCC ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????5 MC:Z:122M RG:Z:NB501576 MQ:i:60 AS:i:117
    NB501576:106:HF7NKAFXY:3:21603:14911:7468 177 chr1 993380 60 122M = 993380 -1 GGAGTGCTGCTCTCACCCCTTTCCCAACAAACCAGCTTCCTGGGGACGTGCTGATGGAGCTTCCTCTTCCTAAAGCTGAACTGGAAAAACAGAAGGTGCACAACGACACGATGTCCTGGCCC ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????5 MC:Z:122M RG:Z:NB501576 MQ:i:60 AS:i:117
    NB501576:106:HF7NKAFXY:3:11609:23425:8266 113 chr1 998927 60 69S79M = 998927 1 CTTGCTCTCTGTCTCTCTCTCCCTCTGTCTCTCTCTCCCTCTCTGTCTCCTCTGTTTCTCTCCCTCTCACACCAAGACAAAGAAAGAAAACTCGTGACGCAGACTCTGGAATAATAAATACGTTTTCTCTGCTACAGTCTCGGCAAAG 555+55???5?5????5???5?????????????5??55?????+???5??????????????????????????????????????????????5???????????????????????????????????????????????????5 SA:Z:chr17,16939369,-,68M80S,60,2; MC:Z:69S79M RG:Z:NB501576 MQ:i:60 AS:i:79
    NB501576:106:HF7NKAFXY:3:11609:23425:8266 177 chr1 998927 60 69S79M = 998927 -1 CTTGCTCTCTGTCTCTCTCTCCCTCTGTCTCTCTCTCCCTCTCTGTCTCCTCTGTTTCTCTCCCTCTCACACCAAGACAAAGAAAGAAAACTCGTGACGCAGACTCTGGAATAATAAATACGTTTTCTCTGCTACAGTCTCGGCAAAG 555+55???5?5????5???5?????????????5??55?????+???5??????????????????????????????????????????????5???????????????????????????????????????????????????5 SA:Z:chr17,16939369,-,68M80S,60,2; MC:Z:69S79M RG:Z:NB501576 MQ:i:60 AS:i:79
    NB501576:106:HF7NKAFXY:2:11311:18954:20209 113 chr1 1005655 60 103M14D48M = 1005655 1 ATGAGCCCCCTGGGTTTATCTGCCCTGCTGGCCCTGGGAAGGCTGGGATGAAAGTGTCATTTAGTGGCAGGGACTTTAGGGAGCCTGGTATGGTCAAGCCCTAGCCCCCGCAGCAGTTCCCCCCGCAGCAGTGCCCCCAGGACAGCTGGGC 5????????????????????????????????????????????????????????????????????????????????????5????????????????????????????????????????????????????????????????? MC:Z:103M14D48M RG:Z:NB501576 MQ:i:60 AS:i:131

  • yfarjounyfarjoun Broad InstituteDev ✭✭✭

    I noticed that most of your (non-duplicate) reads have flags (second column) 65, 129, 113, 177 which are the 4 forms of "tandem" reads, meaning that both reads are aligned in the same direction (FF or RR). GIven that you are surprised by the results, I imagine that you are not using some now-fangled sequencing technology, or otherwise hacking the sequencer to read the same molecule twice from the same end....

    Therefore, I suspect that you have been providing the same fasta file twice to BWA rather than giving it the actual read 1 fasta and the read2 fasta.

    Please check your inputs.

  • nelsonobhknelsonobhk Member

    @yfarjoun, I've checked the uBAM file, it looks like the problem is exactly what you mentioned. I'm trying to rework from the uBAM again. Thanks a lot!

Sign In or Register to comment.