Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

SVPreprocess ERROR

wangqiwangqi Member

Hi:
I'm using Genome STRIP to call SV on my 5 test bam file, but on the first step--SVPreprocess, it has a error. The error looks no big deal, but when I keep on the second step--SVDiscovery, it can't output the VCF file. I'm new on this project so I'm very confused. Hope you can help me. Thank you very much! Here are my scripts, the error and warn message:

1.MY BAM LIST: test.list
/pnas/xiaojf_group/wangqi/call_SV/data/21916539.recal.bam
/pnas/xiaojf_group/wangqi/call_SV/data/21777428.recal.bam
/pnas/xiaojf_group/wangqi/call_SV/data/21757076.recal.bam
/pnas/xiaojf_group/wangqi/call_SV/data/21202566.recal.bam
/pnas/xiaojf_group/wangqi/call_SV/data/21078731.recal.bam
2.MY SVPreprocess script:test.sh

PBS -q core24

PBS -l mem=30gb,walltime=3:00:00,nodes=1:ppn=1

HSCHED -s test+gatk+human

cd /pnas/xiaojf_group/wangqi/call_SV/

classpath="${SV_DIR}/lib/SVToolkit.jar:${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar:${SV_DIR}/lib/gatk/Queue.jar"
java -Xmx4g -cp ${classpath} \
org.broadinstitute.gatk.queue.QCommandLine \
-S ${SV_DIR}/qscript/SVPreprocess.q \
-S ${SV_DIR}/qscript/SVQScript.q \
-cp ${classpath} \
-gatk ${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar \
-configFile ${SV_DIR}/conf/genstrip_parameters.txt \
-R /pnas/xiaojf_group/wangqi/call_SV/data/human.fa \
-I /pnas/xiaojf_group/wangqi/call_SV/test.list \
-md /pnas/xiaojf_group/wangqi/call_SV/metadata \
-bamFilesAreDisjoint true\
-jobLogDir /pnas/xiaojf_group/wangqi/call_SV/Logs \
-run
3.SVPreprocess Error message:
......
ERROR 07:48:20,823 FunctionEdge - Error: 'java' '-Xmx2048m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/pnas/xiao
jf_group/wangqi/call_SV/.queue/tmp' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVCommandLine '-T' 'ComputeInsertSizeHistogramsWalker' '-R' '/pnas/xiaojf_group/wangqi/call_SV/data/human.fa' '-I' '/pnas/xiaojf_group/wangqi/call_SV/data/21202566.recal.bam' '-O' '/pnas/xiaojf_group/wangqi/call_SV/metadata/isd/21202566.recal.hist.bin' '-disableGATKTraversal' 'true' '-md' '/pnas/xiaojf_group/wangqi/call_SV/metadata' '-configFile' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/conf/genstrip_parameters.txt' '-chimerismFile' '/pnas/xiaojf_group/wangqi/call_SV/metadata/isd/21202566.recal.chimer.dat' '-createHistogramFile' 'true' -createEmpty
ERROR 07:48:22,158 FunctionEdge - Contents of /pnas/xiaojf_group/wangqi/call_SV/Logs/SVPreprocess-10.out:
INFO 05:43:29,974 17-Apr-2018 ProgressMeter - Starting 0.0 35.0 m 3472.4 w 100.0% 35.0 m 0.0 s
INFO 05:43:59,975 17-Apr-2018 ProgressMeter - Starting 0.0 35.5 m 3522.0 w 100.0% 35.5 m 0.0 s
INFO 05:44:39,976 17-Apr-2018 ProgressMeter - Starting 0.0 36.2 m 3588.2 w 100.0% 36.2 m 0.0 s
INFO 05:45:09,976 17-Apr-2018 ProgressMeter - Starting 0.0 36.7 m 3637.8 w 100.0% 36.7 m 0.0 s
INFO 05:45:39,977 17-Apr-2018 ProgressMeter - Starting 0.0 37.2 m 3687.4 w 100.0% 37.2 m 0.0 s
INFO 05:46:09,978 17-Apr-2018 ProgressMeter - Starting 0.0 37.7 m 3737.0 w 100.0% 37.7 m 0.0 s
INFO 05:46:49,979 17-Apr-2018 ProgressMeter - Starting 0.0 38.3 m 3803.1 w 100.0% 38.3 m 0.0 s
INFO 05:47:19,980 17-Apr-2018 ProgressMeter - Starting 0.0 38.8 m 3852.7 w 100.0% 38.8 m 0.0 s
INFO 05:47:59,981 17-Apr-2018 ProgressMeter - Starting 0.0 39.5 m 3918.8 w 100.0% 39.5 m 0.0 s
INFO 05:48:29,981 17-Apr-2018 ProgressMeter - Starting 0.0 40.0 m 3968.5 w 100.0% 40.0 m 0.0 s
INFO 05:48:59,982 17-Apr-2018 ProgressMeter - Starting 0.0 40.5 m 4018.1 w 100.0% 40.5 m 0.0 s
INFO 05:49:29,983 17-Apr-2018 ProgressMeter - Starting 0.0 41.0 m 4067.7 w 100.0% 41.0 m 0.0 s
INFO 05:50:09,984 17-Apr-2018 ProgressMeter - Starting 0.0 41.7 m 4133.8 w 100.0% 41.7 m 0.0 s
INFO 05:50:39,984 17-Apr-2018 ProgressMeter - Starting 0.0 42.2 m 4183.4 w 100.0% 42.2 m 0.0 s
INFO 05:51:10,000 17-Apr-2018 ProgressMeter - Starting 0.0 42.7 m 4233.0 w 100.0% 42.7 m 0.0 s
INFO 05:51:40,000 17-Apr-2018 ProgressMeter - Starting 0.0 43.2 m 4282.6 w 100.0% 43.2 m 0.0 s
INFO 05:52:10,001 17-Apr-2018 ProgressMeter - Starting 0.0 43.7 m 4332.2 w 100.0% 43.7 m 0.0 s
INFO 05:52:40,002 17-Apr-2018 ProgressMeter - Starting 0.0 44.2 m 4381.8 w 100.0% 44.2 m 0.0 s
INFO 05:53:20,003 17-Apr-2018 ProgressMeter - Starting 0.0 44.8 m 4448.0 w 100.0% 44.8 m 0.0 s
INFO 05:53:50,003 17-Apr-2018 ProgressMeter - Starting 0.0 45.3 m 4497.6 w 100.0% 45.3 m 0.0 s
INFO 05:54:20,004 17-Apr-2018 ProgressMeter - Starting 0.0 45.8 m 4547.2 w 100.0% 45.8 m 0.0 s
INFO 05:55:00,005 17-Apr-2018 ProgressMeter - Starting 0.0 46.5 m 4613.3 w 100.0% 46.5 m 0.0 s
INFO 05:55:40,006 17-Apr-2018 ProgressMeter - Starting 0.0 47.2 m 4679.5 w 100.0% 47.2 m 0.0 s
INFO 05:56:10,006 17-Apr-2018 ProgressMeter - Starting 0.0 47.7 m 4729.1 w 100.0% 47.7 m 0.0 s
INFO 05:56:40,007 17-Apr-2018 ProgressMeter - Starting 0.0 48.2 m 4778.7 w 100.0% 48.2 m 0.0 s
INFO 05:57:20,008 17-Apr-2018 ProgressMeter - Starting 0.0 48.8 m 4844.8 w 100.0% 48.8 m 0.0 s
INFO 05:57:50,008 17-Apr-2018 ProgressMeter - Starting 0.0 49.3 m 4894.4 w 100.0% 49.3 m 0.0 s
INFO 05:58:20,009 17-Apr-2018 ProgressMeter - Starting 0.0 49.8 m 4944.0 w 100.0% 49.8 m 0.0 s
INFO 05:58:50,010 17-Apr-2018 ProgressMeter - Starting 0.0 50.3 m 4993.6 w 100.0% 50.3 m 0.0 s
INFO 05:59:30,011 17-Apr-2018 ProgressMeter - Starting 0.0 51.0 m 5059.8 w 100.0% 51.0 m 0.0 s
INFO 06:00:00,011 17-Apr-2018 ProgressMeter - Starting 0.0 51.5 m 5109.4 w 100.0% 51.5 m 0.0 s
INFO 06:00:30,012 17-Apr-2018 ProgressMeter - Starting 0.0 52.0 m 5159.0 w 100.0% 52.0 m 0.0 s
INFO 06:01:00,013 17-Apr-2018 ProgressMeter - Starting 0.0 52.5 m 5208.6 w 100.0% 52.5 m 0.0 s
INFO 06:01:40,014 17-Apr-2018 ProgressMeter - Starting 0.0 53.2 m 5274.7 w 100.0% 53.2 m 0.0 s
INFO 06:02:10,015 17-Apr-2018 ProgressMeter - Starting 0.0 53.7 m 5324.3 w 100.0% 53.7 m 0.0 s
INFO 06:02:40,018 17-Apr-2018 ProgressMeter - Starting 0.0 54.2 m 5373.9 w 100.0% 54.2 m 0.0 s
INFO 06:03:10,022 17-Apr-2018 ProgressMeter - Starting 0.0 54.7 m 5423.5 w 100.0% 54.7 m 0.0 s
INFO 06:03:40,026 17-Apr-2018 ProgressMeter - Starting 0.0 55.2 m 5473.2 w 100.0% 55.2 m 0.0 s
INFO 06:04:10,027 17-Apr-2018 ProgressMeter - Starting 0.0 55.7 m 5522.8 w 100.0% 55.7 m 0.0 s
INFO 06:04:40,031 17-Apr-2018 ProgressMeter - Starting 0.0 56.2 m 5572.4 w 100.0% 56.2 m 0.0 s
INFO 06:05:10,033 17-Apr-2018 ProgressMeter - Starting 0.0 56.7 m 5622.0 w 100.0% 56.7 m 0.0 s
INFO 06:05:40,035 17-Apr-2018 ProgressMeter - Starting 0.0 57.2 m 5671.6 w 100.0% 57.2 m 0.0 s
INFO 06:06:10,036 17-Apr-2018 ProgressMeter - Starting 0.0 57.7 m 5721.2 w 100.0% 57.7 m 0.0 s
INFO 06:06:40,038 17-Apr-2018 ProgressMeter - Starting 0.0 58.2 m 5770.8 w 100.0% 58.2 m 0.0 s
INFO 06:07:10,040 17-Apr-2018 ProgressMeter - Starting 0.0 58.7 m 5820.4 w 100.0% 58.7 m 0.0 s
INFO 06:07:40,042 17-Apr-2018 ProgressMeter - Starting 0.0 59.2 m 5870.0 w 100.0% 59.2 m 0.0 s
INFO 06:08:10,043 17-Apr-2018 ProgressMeter - Starting 0.0 59.7 m 5919.6 w 100.0% 59.7 m 0.0 s
INFO 06:08:40,045 17-Apr-2018 ProgressMeter - Starting 0.0 60.2 m 5969.2 w 100.0% 60.2 m 0.0 s
INFO 06:09:10,046 17-Apr-2018 ProgressMeter - Starting 0.0 60.7 m 6018.8 w 100.0% 60.7 m 0.0 s
INFO 06:09:40,048 17-Apr-2018 ProgressMeter - Starting 0.0 61.2 m 6068.4 w 100.0% 61.2 m 0.0 s
INFO 06:10:10,049 17-Apr-2018 ProgressMeter - Starting 0.0 61.7 m 6118.0 w 100.0% 61.7 m 0.0 s
INFO 06:10:40,051 17-Apr-2018 ProgressMeter - Starting 0.0 62.2 m 6167.6 w 100.0% 62.2 m 0.0 s
INFO 06:11:10,053 17-Apr-2018 ProgressMeter - Starting 0.0 62.7 m 6217.2 w 100.0% 62.7 m 0.0 s
INFO 06:11:40,054 17-Apr-2018 ProgressMeter - Starting 0.0 63.2 m 6266.9 w 100.0% 63.2 m 0.0 s
INFO 06:12:10,056 17-Apr-2018 ProgressMeter - Starting 0.0 63.7 m 6316.5 w 100.0% 63.7 m 0.0 s
INFO 06:12:40,057 17-Apr-2018 ProgressMeter - Starting 0.0 64.2 m 6366.1 w 100.0% 64.2 m 0.0 s
INFO 06:13:10,059 17-Apr-2018 ProgressMeter - Starting 0.0 64.7 m 6415.7 w 100.0% 64.7 m 0.0 s
INFO 06:13:40,060 17-Apr-2018 ProgressMeter - Starting 0.0 65.2 m 6465.3 w 100.0% 65.2 m 0.0 s
INFO 06:14:10,062 17-Apr-2018 ProgressMeter - Starting 0.0 65.7 m 6514.9 w 100.0% 65.7 m 0.0 s
INFO 06:14:40,063 17-Apr-2018 ProgressMeter - Starting 0.0 66.2 m 6564.5 w 100.0% 66.2 m 0.0 s
INFO 06:15:10,065 17-Apr-2018 ProgressMeter - Starting 0.0 66.7 m 6614.1 w 100.0% 66.7 m 0.0 s
INFO 06:15:40,066 17-Apr-2018 ProgressMeter - Starting 0.0 67.2 m 6663.7 w 100.0% 67.2 m 0.0 s
INFO 06:16:10,068 17-Apr-2018 ProgressMeter - Starting 0.0 67.7 m 6713.3 w 100.0% 67.7 m 0.0 s
INFO 06:16:40,070 17-Apr-2018 ProgressMeter - Starting 0.0 68.2 m 6762.9 w 100.0% 68.2 m 0.0 s
INFO 06:17:10,071 17-Apr-2018 ProgressMeter - Starting 0.0 68.7 m 6812.5 w 100.0% 68.7 m 0.0 s
INFO 06:17:40,075 17-Apr-2018 ProgressMeter - Starting 0.0 69.2 m 6862.1 w 100.0% 69.2 m 0.0 s
INFO 06:18:10,077 17-Apr-2018 ProgressMeter - Starting 0.0 69.7 m 6911.7 w 100.0% 69.7 m 0.0 s
INFO 06:18:40,078 17-Apr-2018 ProgressMeter - Starting 0.0 70.2 m 6961.3 w 100.0% 70.2 m 0.0 s
INFO 06:19:10,080 17-Apr-2018 ProgressMeter - Starting 0.0 70.7 m 7010.9 w 100.0% 70.7 m 0.0 s
INFO 06:19:40,081 17-Apr-2018 ProgressMeter - Starting 0.0 71.2 m 7060.5 w 100.0% 71.2 m 0.0 s
INFO 06:20:10,083 17-Apr-2018 ProgressMeter - Starting 0.0 71.7 m 7110.2 w 100.0% 71.7 m 0.0 s
INFO 06:20:40,084 17-Apr-2018 ProgressMeter - Starting 0.0 72.2 m 7159.8 w 100.0% 72.2 m 0.0 s
INFO 06:21:10,086 17-Apr-2018 ProgressMeter - Starting 0.0 72.7 m 7209.4 w 100.0% 72.7 m 0.0 s
INFO 06:21:40,087 17-Apr-2018 ProgressMeter - Starting 0.0 73.2 m 7259.0 w 100.0% 73.2 m 0.0 s
INFO 06:22:10,089 17-Apr-2018 ProgressMeter - Starting 0.0 73.7 m 7308.6 w 100.0% 73.7 m 0.0 s
INFO 06:22:40,091 17-Apr-2018 ProgressMeter - Starting 0.0 74.2 m 7358.2 w 100.0% 74.2 m 0.0 s
INFO 06:23:10,092 17-Apr-2018 ProgressMeter - Starting 0.0 74.7 m 7407.8 w 100.0% 74.7 m 0.0 s
INFO 06:23:40,094 17-Apr-2018 ProgressMeter - Starting 0.0 75.2 m 7457.4 w 100.0% 75.2 m 0.0 s
INFO 06:24:10,095 17-Apr-2018 ProgressMeter - Starting 0.0 75.7 m 7507.0 w 100.0% 75.7 m 0.0 s
INFO 06:24:40,097 17-Apr-2018 ProgressMeter - Starting 0.0 76.2 m 7556.6 w 100.0% 76.2 m 0.0 s
INFO 06:25:10,098 17-Apr-2018 ProgressMeter - Starting 0.0 76.7 m 7606.2 w 100.0% 76.7 m 0.0 s
INFO 06:25:40,099 17-Apr-2018 ProgressMeter - Starting 0.0 77.2 m 7655.8 w 100.0% 77.2 m 0.0 s
INFO 06:26:10,101 17-Apr-2018 ProgressMeter - Starting 0.0 77.7 m 7705.4 w 100.0% 77.7 m 0.0 s
INFO 06:26:40,103 17-Apr-2018 ProgressMeter - Starting 0.0 78.2 m 7755.0 w 100.0% 78.2 m 0.0 s
INFO 06:27:10,104 17-Apr-2018 ProgressMeter - Starting 0.0 78.7 m 7804.6 w 100.0% 78.7 m 0.0 s
INFO 06:27:40,106 17-Apr-2018 ProgressMeter - Starting 0.0 79.2 m 7854.2 w 100.0% 79.2 m 0.0 s
INFO 06:28:10,107 17-Apr-2018 ProgressMeter - Starting 0.0 79.7 m 7903.8 w 100.0% 79.7 m 0.0 s
INFO 06:28:40,109 17-Apr-2018 ProgressMeter - Starting 0.0 80.2 m 7953.5 w 100.0% 80.2 m 0.0 s
INFO 06:29:10,110 17-Apr-2018 ProgressMeter - Starting 0.0 80.7 m 8003.1 w 100.0% 80.7 m 0.0 s
INFO 06:29:40,112 17-Apr-2018 ProgressMeter - Starting 0.0 81.2 m 8052.7 w 100.0% 81.2 m 0.0 s
INFO 06:30:10,113 17-Apr-2018 ProgressMeter - Starting 0.0 81.7 m 8102.3 w 100.0% 81.7 m 0.0 s
INFO 06:30:40,115 17-Apr-2018 ProgressMeter - Starting 0.0 82.2 m 8151.9 w 100.0% 82.2 m 0.0 s
INFO 06:31:10,116 17-Apr-2018 ProgressMeter - Starting 0.0 82.7 m 8201.5 w 100.0% 82.7 m 0.0 s
INFO 06:31:40,118 17-Apr-2018 ProgressMeter - Starting 0.0 83.2 m 8251.1 w 100.0% 83.2 m 0.0 s
INFO 06:32:10,119 17-Apr-2018 ProgressMeter - Starting 0.0 83.7 m 8300.7 w 100.0% 83.7 m 0.0 s
INFO 06:32:33,080 17-Apr-2018 ProgressMeter - done 0.0 84.1 m 8338.7 w 100.0% 84.1 m 0.0 s

INFO 06:32:33,081 17-Apr-2018 ProgressMeter - Total runtime 5043.22 secs, 84.05 min, 1.40 hours

Done. There were no warn messages.

......
WARN 07:49:25,124 RScriptExecutor - Skipping: Rscript (resource)org/broadinstitute/gatk/queue/util/queueJobReport.R /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess.jobreport.txt /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess.jobreport.pdf

......
There were 1 WARN messages, the first 1 are repeated below.
WARN 07:49:25,124 RScriptExecutor - Skipping: Rscript (resource)org/broadinstitute/gatk/queue/util/queueJobReport.R /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess.jobreport.txt /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess.jobreport.pdf

4.SVDiscovery error message:
......

ERROR --
ERROR stack trace

java.lang.RuntimeException: Error processing input from /pnas/xiaojf_group/wangqi/call_SV/data2/21916539.recal.bam: null
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runTraversal(DeletionDiscoveryAlgorithm.java:159)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:105)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:40)
at org.broadinstitute.gatk.engine.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at org.broadinstitute.gatk.engine.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:115)
at org.broadinstitute.gatk.engine.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:316)
at org.broadinstitute.gatk.engine.CommandLineExecutable.execute(CommandLineExecutable.java:123)
at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:133)
at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:256)
at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:158)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:87)
at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
Caused by: java.lang.NullPointerException
at org.broadinstitute.sv.metadata.isize.InsertRadiusMap.init(InsertRadiusMap.java:52)
at org.broadinstitute.sv.metadata.isize.InsertRadiusMap.(InsertRadiusMap.java:35)
at org.broadinstitute.sv.discovery.ReadPairInsertSizeSelector.initMinimumRadiusMap(ReadPairInsertSizeSelector.java:102)
at org.broadinstitute.sv.discovery.ReadPairInsertSizeSelector.getMinimumInsertSize(ReadPairInsertSizeSelector.java:86)
at org.broadinstitute.sv.discovery.ReadPairInsertSizeSelector.selectReadPairRecord(ReadPairInsertSizeSelector.java:62)
at org.broadinstitute.sv.discovery.ReadPairRecordSelector.selectReadPairRecord(ReadPairRecordSelector.java:107)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processRead(DeletionDiscoveryAlgorithm.java:172)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runTraversal(DeletionDiscoveryAlgorithm.java:151)
... 11 more

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 3.7.GS-r1748-0-g74bfe0b):
ERROR
ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
ERROR If not, please post the error message, with stack trace, to the GATK forum.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions https://software.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Error processing input from /pnas/xiaojf_group/wangqi/call_SV/data2/21916539.recal.bam: null
ERROR ------------------------------------------------------------------------------------------

ERROR 19:52:35,047 FunctionEdge - Error: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/pnas/xiaojf_group/wangqi/call_SV/SVDiscovery2/.queue/tmp' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVDiscovery '-T' 'SVDiscoveryWalker' '-R' '/pnas/xiaojf_group/wangqi/call_SV/data2/human.fa' '-I' '/pnas/xiaojf_group/wangqi/call_SV/test.list' '-O' '/pnas/xiaojf_group/wangqi/call_SV/SVDiscovery2/P0010.discovery.vcf.gz' '-disableGATKTraversal' 'true' '-md' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess2/metadata' '-configFile' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/conf/genstrip_parameters.txt' '-runDirectory' '/pnas/xiaojf_group/wangqi/call_SV/SVDiscovery2' '-partitionName' 'P0010' '-runFilePrefix' 'P0010' '-storeReadPairFile' 'true' -L 10:1-135534747 -searchLocus 10:1-135534747 -searchWindow 10:1-135534747 -searchMinimumSize 100 -searchMaximumSize 100000
ERROR 19:52:35,048 FunctionEdge - Contents of /pnas/xiaojf_group/wangqi/call_SV/SVDiscovery2/Logs/SVDiscovery-10.out:
INFO 19:50:58,604 HelpFormatter - -----------------------------------------------------------------------------------------
INFO 19:50:58,607 HelpFormatter - The Genome Analysis Toolkit (GATK) v3.7.GS-r1748-0-g74bfe0b, Compiled 2017/10/06 08:08:49
INFO 19:50:58,607 HelpFormatter - Copyright (c) 2010-2016 The Broad Institute
INFO 19:50:58,607 HelpFormatter - For support and documentation go to https://software.broadinstitute.org/gatk
INFO 19:50:58,607 HelpFormatter - [Tue Apr 17 19:50:58 CST 2018] Executing on Linux 3.10.0-327.el7.x86_64 amd64
INFO 19:50:58,607 HelpFormatter - Java HotSpot(TM) 64-Bit Server VM 1.8.0_121-b13
INFO 19:50:58,612 HelpFormatter - Program Args: -T SVDiscoveryWalker -R /pnas/xiaojf_group/wangqi/call_SV/data2/human.fa -O /pnas/xiaojf_group/wangqi/call_SV/SVDiscovery2/P0010.discovery.vcf.gz -disableGATKTraversal true -md /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess2/metadata -configFile /pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/conf/genstrip_parameters.txt -runDirectory /pnas/xiaojf_group/wangqi/call_SV/SVDiscovery2 -partitionName P0010 -runFilePrefix P0010 -storeReadPairFile true -L 10:1-135534747 -searchLocus 10:1-135534747 -searchWindow 10:1-135534747 -searchMinimumSize 100 -searchMaximumSize 100000
INFO 19:50:58,614 HelpFormatter - Executing as [email protected] on Linux 3.10.0-327.el7.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_121-b13.
INFO 19:50:58,614 HelpFormatter - Date/Time: 2018/04/17 19:50:58
INFO 19:50:58,614 HelpFormatter - -----------------------------------------------------------------------------------------
INFO 19:50:58,614 HelpFormatter - -----------------------------------------------------------------------------------------
INFO 19:50:58,620 17-Apr-2018 GenomeAnalysisEngine - Strictness is SILENT
INFO 19:50:58,771 17-Apr-2018 GenomeAnalysisEngine - Downsampling Settings: No downsampling
INFO 19:50:58,790 17-Apr-2018 IntervalUtils - Processing 135534747 bp from intervals
INFO 19:50:58,841 17-Apr-2018 GenomeAnalysisEngine - Preparing for traversal
INFO 19:50:58,845 17-Apr-2018 GenomeAnalysisEngine - Done preparing for traversal
INFO 19:50:58,845 17-Apr-2018 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING]
INFO 19:50:58,845 17-Apr-2018 ProgressMeter - | processed | time | per 1M | | total | remaining
INFO 19:50:58,846 17-Apr-2018 ProgressMeter - Location | reads | elapsed | reads | completed | runtime | runtime
INFO 19:50:58,846 17-Apr-2018 SVDiscovery - Initializing SVDiscovery ...
INFO 19:50:58,846 17-Apr-2018 SVDiscovery - Reading configuration file ...
INFO 19:50:58,849 17-Apr-2018 SVDiscovery - Read configuration file.
INFO 19:50:58,849 17-Apr-2018 SVDiscovery - Opening reference sequence ...
INFO 19:50:58,850 17-Apr-2018 SVDiscovery - Opened reference sequence.
INFO 19:50:58,850 17-Apr-2018 SVDiscovery - Initializing input data set ...
INFO 19:50:58,875 17-Apr-2018 SVDiscovery - Initialized data set: 5 files, 5 read groups, 5 samples.
INFO 19:50:58,876 17-Apr-2018 MetaData - Opening metadata ...
INFO 19:50:58,876 17-Apr-2018 MetaData - Adding metadata location /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess2/metadata ...
INFO 19:50:58,878 17-Apr-2018 MetaData - Opened metadata.
INFO 19:50:58,878 17-Apr-2018 SVDiscovery - Opened metadata.
INFO 19:50:59,186 17-Apr-2018 SVDiscovery - Processing locus: 10:1-135534747:100-100000
INFO 19:50:59,186 17-Apr-2018 SVDiscovery - Locus search window: 10:1-135534747
Caught exception while processing read: K00386:19:HGJTKBBXX:3:2101:17624:32595 163 10 60005 0 101M = 60166 262 TCCTTGAGGCCTAAATGCATCGGGGTGCTCTGGTTTTGTTGTTGTTATTTCTGAATGACATTTACTTTGGTGCTCTTTATTTTGCGCATTTAAAACTATTA ==<?>@???@>;>>[email protected]?@==@[email protected][email protected]?>=<= XA:Z:18,+14419,101M,1; MC:Z:101M BD:Z:JJMMLMNMONNMMJBJLNNLLJJHHLHNNJJMLLJBBJHJJHJJHJIIIBJJMLIJLLLHLIBILLICKMMIOOKKJCJJJDDLPMMPOLELNFFORMJJJ MD:Z:86T14 PG:Z:MarkDuplicates RG:Z:21916539 BI:Z:LLKONPPONONOOKELMNOMMJIHHMIMOIKNKMKDDLJKMKLMKLMKKEKLONKLMNMKNLFNNOLFNMOLPRLNMGOMMGHPQNNRQOIRPJKSUOLLN NM:i:1 MQ:i:0 AS:i:96 XS:i:96
......
similar errors
......
5.MY SVDiscovery script:test.sh

PBS -q core24

PBS -l mem=30gb,walltime=3:00:00,nodes=1:ppn=1

HSCHED -s test+gatk+human

cd /pnas/xiaojf_group/wangqi/call_SV/SVDiscovery
classpath="${SV_DIR}/lib/SVToolkit.jar:${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar:${SV_DIR}/lib/gatk/Queue.jar"
java -Xmx4g -cp ${classpath} \
org.broadinstitute.gatk.queue.QCommandLine \
-S ${SV_DIR}/qscript/SVDiscovery.q \
-S ${SV_DIR}/qscript/SVQScript.q \
-cp ${classpath} \
-gatk ${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar \
-configFile ${SV_DIR}/conf/genstrip_parameters.txt \
-R /pnas/xiaojf_group/wangqi/call_SV/data/human.fa \
-I /pnas/xiaojf_group/wangqi/call_SV/test.list \
-md /pnas/xiaojf_group/wangqi/call_SV/metadata \
-runDirectory /pnas/xiaojf_group/wangqi/call_SV/SVDiscovery \
-jobLogDir /pnas/xiaojf_group/wangqi/call_SV/SVDiscovery/Logs \
-O /pnas/xiaojf_group/wangqi/call_SV/SVDiscovery/svdiscovery.dels.vcf \
-minimumSize 100 \
-maximumSize 100000 \
-run

Answers

  • bhandsakerbhandsaker Member, Broadie, Moderator admin

    The first thing is that you need to download a supported reference metadata bundle from here:
    ftp://ftp.broadinstitute.org/pub/svtoolkit/reference_metadata_bundles
    Untar the file and point the -R argument to the .fasta file in that reference metadata directory. Newer versions of Genome STRiP default important settings based on the path to the -R file.

  • wangqiwangqi Member

    @bhandsaker said:
    The first thing is that you need to download a supported reference metadata bundle from here:
    ftp://ftp.broadinstitute.org/pub/svtoolkit/reference_metadata_bundles
    Untar the file and point the -R argument to the .fasta file in that reference metadata directory. Newer versions of Genome STRiP default important settings based on the path to the -R file.

    Thanks very much for your help.

    I have download the hg19 reference data from the ftp site, and point the -R arugment, but it still has some other ERRORs, can you tell me why?

    ERROR MESSAGE

    ERROR1

    ERROR 18:48:28,137 FunctionEdge - Error: 'java' '-Xmx2048m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/.queue/tmp' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.SVToolkitInfo'
    ERROR 18:48:28,142 FunctionEdge - Contents of /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/svtoolkit.version.dat:
    SVToolkit version 2.00 (build 1774)
    Build date: 2017/10/06 12:56:31
    Web site: http://www.broadinstitute.org/software/genomestrip


    ERROR2

    ERROR 04:48:18,582 FunctionEdge - Error: 'java' '-Xmx2048m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/.queue/tmp' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVCommandLine '-T' 'ComputeMetadataWalker' '-R' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.fasta' '-I' '/pnas/xiaojf_group/wangqi/call_SV/data/21757076.recal.bam' '-disableGATKTraversal' 'true' '-md' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata' '-computeGCProfiles' 'true' '-computeReadCounts' 'true' '-depthFile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/depth/21757076.recal.depth.txt' '-spanFile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/spans/21757076.recal.spans.txt' '-gcProfileFile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/gcprofile/21757076.recal.bam.gcprof.zip' '-readCountFile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/rccache/21757076.recal.rc.bin' '-configFile' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/conf/genstrip_parameters.txt' '-ploidyMapFile' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.ploidymap.txt' '-genomeMaskFile' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.svmask.fasta' '-copyNumberMaskFile' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.gcmask.fasta' '-readDepthMaskFile' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.rdmask.bed' '-minMapQ' '10' '-maxInsertSizeStandardDeviations' '3' '-insertSizeRadius' '10.0' '-referenceProfile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/gcprofile/reference.gcprof.zip'
    ERROR 04:48:18,592 FunctionEdge - Contents of /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/Logs/SVPreprocess-24.out:
    INFO 22:55:57,632 04-May-2018 ProgressMeter - Starting 0.0 84.2 m 8350.7 w 100.0% 84.2 m 0.0 s
    INFO 22:56:37,633 04-May-2018 ProgressMeter - Starting 0.0 84.8 m 8416.8 w 100.0% 84.8 m 0.0 s
    .....
    INFO 23:47:18,547 04-May-2018 ProgressMeter - Starting 0.0 2.3 h 13444.8 w 100.0% 2.3 h 0.0 s
    INFO 23:47:44,423 04-May-2018 ProgressMeter - done 0.0 2.3 h 13487.6 w 100.0% 2.3 h 0.0 s
    INFO 23:47:44,423 04-May-2018 ProgressMeter - Total runtime 8157.29 secs, 135.95 min, 2.27 hours
    Done. There were no warn messages.


    ERROR3

    ERROR 05:03:44,744 FunctionEdge - Error: 'java' '-Xmx2048m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/.queue/tmp' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.IndexReadCountFile' '-I' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/rccache/21916539.recal.rc.bin' '-O' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/rccache/21916539.recal.rc.bin.idx'
    ERROR 05:03:44,745 FunctionEdge - Contents of /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/Logs/SVPreprocess-21.out:
    INFO 04:48:32,799 HelpFormatter - -----------------------------------------------------------
    INFO 04:48:32,801 HelpFormatter - Program Name: org.broadinstitute.sv.apps.IndexReadCountFile
    INFO 04:48:32,826 HelpFormatter - Program Args: -I /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/rccache/21916539.recal.rc.bin -O /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/rccache/21916539.recal.rc.bin.idx
    INFO 04:48:32,832 HelpFormatter - Executing as [email protected] on Linux 3.10.0-327.el7.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_121-b13.
    INFO 04:48:32,846 HelpFormatter - Date/Time: 2018/05/05 04:48:32
    INFO 04:48:32,846 HelpFormatter - -----------------------------------------------------------
    INFO 04:48:32,853 HelpFormatter - -----------------------------------------------------------
    INFO 04:52:49,382 CommandLineProgram - Program completed.
    Done. There were no warn messages.


    ERROR4

    WARN 05:03:44,944 RScriptExecutor - Skipping: Rscript (resource)org/broadinstitute/gatk/queue/util/queueJobReport.R /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/SVPreprocess.jobreport.txt /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/SVPreprocess.jobreport.pdf
    INFO 05:03:44,947 QCommandLine - Done with errors
    INFO 05:03:45,078 QGraph - -------
    INFO 05:03:45,079 QGraph - Failed: 'java' '-Xmx2048m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/.queue/tmp' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.IndexReadCountFile' '-I' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/rccache/21916539.recal.rc.bin' '-O' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/rccache/21916539.recal.rc.bin.idx'
    INFO 05:03:45,079 QGraph - Log: /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/Logs/SVPreprocess-21.out
    INFO 05:03:45,079 QGraph - -------
    INFO 05:03:45,080 QGraph - Failed: 'java' '-Xmx2048m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/.queue/tmp' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVCommandLine '-T' 'ComputeMetadataWalker' '-R' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.fasta' '-I' '/pnas/xiaojf_group/wangqi/call_SV/data/21757076.recal.bam' '-disableGATKTraversal' 'true' '-md' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata' '-computeGCProfiles' 'true' '-computeReadCounts' 'true' '-depthFile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/depth/21757076.recal.depth.txt' '-spanFile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/spans/21757076.recal.spans.txt' '-gcProfileFile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/gcprofile/21757076.recal.bam.gcprof.zip' '-readCountFile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/rccache/21757076.recal.rc.bin' '-configFile' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/conf/genstrip_parameters.txt' '-ploidyMapFile' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.ploidymap.txt' '-genomeMaskFile' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.svmask.fasta' '-copyNumberMaskFile' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.gcmask.fasta' '-readDepthMaskFile' '/pnas/xiaojf_group/wangqi/call_SV/data/Homo_sapiens_assembly19/Homo_sapiens_assembly19.rdmask.bed' '-minMapQ' '10' '-maxInsertSizeStandardDeviations' '3' '-insertSizeRadius' '10.0' '-referenceProfile' '/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/gcprofile/reference.gcprof.zip'
    INFO 05:03:45,080 QGraph - Log: /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/Logs/SVPreprocess-24.out
    INFO 05:03:45,080 QGraph - -------
    INFO 05:03:45,080 QGraph - Failed: 'java' '-Xmx2048m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/.queue/tmp' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' '-cp' '/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/SVToolkit.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/pnas/xiaojf_group/wangqi/software/genome_strip/svtoolkit/lib/gatk/Queue.jar' 'org.broadinstitute.sv.apps.SVToolkitInfo'
    INFO 05:03:45,080 QGraph - Log: /pnas/xiaojf_group/wangqi/call_SV/SVPreprocess/metadata/svtoolkit.version.dat
    INFO 05:03:45,081 QCommandLine - Script failed: 781 Pend, 0 Run, 3 Fail, 25 Done
    Done.


    Thank you in advance!

    wangqi

  • bhandsakerbhandsaker Member, Broadie, Moderator admin

    In the examples you show, it looks like the jobs are in fact completing successfully.

    This is often a symptom that there is some problem in coordination between Queue (the workflow execution software) and your job scheduler (looks like PBS). Queue uses the DRMAA API to submit jobs. These kinds of problems can happen if either the job returns a non-zero exit status for some reason (even though the job succeeded) or if Queue loses track of the job status or thinks the job failed.

    One workaround is to simply rerun the Queue invocation (with the same parameters). Queue will retry just the jobs that failed (and then run any downstream jobs that depend on them if they succeed). Often these problems are transient and things will work when you run the job again.

Sign In or Register to comment.