Attention:
The frontline support team will be unavailable to answer questions on April 15th and 17th 2019. We will be back soon after. Thank you for your patience and we apologize for any inconvenience!

A GATK RUNTIME ERROR, Invalid alignment found, alignmentStart > alignemntEnd

Hi, I was in the second step of Genome STRiP, to discover SV. It seems that all "partition" jobs worked fine, except one. The error message looks like this:

ERROR 00:12:01,906 FunctionEdge - Contents of /u/flashscratch/h/hjzhou/biploar_del_discovery_out/deletions100k/logs/SVDiscovery-203.out:
...
##### ERROR stack trace
java.lang.RuntimeException: Invalid alignment found, alignmentStart (1231809) > alignemntEnd (1231808) HS2000-887_377:1:1112:13543:35396        81      chr12   1231809 70      62I38S  =       1230685 -1124   ATCTCTATCTCTATCTCTATCTGTGCCTATTGATATATCTGTATATATCTATCTAAATCTCTATCTCTATCTCTATCTGTGCCTATTGATATATCTGTAT    [email protected]>EFECFEDBEAHHHIIIHEHGHGIIJIIGIIG[email protected]C    SA:Z:chr12,1231809,-,56S44M,60,1;       MC:Z:100M       OC:Z:62M38S     RG:Z:LP6005646-DNA_B05  NM:i:62 MQ:i:60 AS:i:57 XS:i:25
...

I am very new to Genome STRiP and GATK. Any clue or advice would be helpful.

Best Answer

Answers

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @hjzhou
    Hi,

    I just moved your question to GenomeSTRiP section where @bhandsaker can help you.

    -Sheila

  • Thank you @Sheila. I wasn't ware that I posted in the wrong section.

Sign In or Register to comment.