Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Oncotator 1.9.2 wrong annotation

Dear oncotator team

I have recently updated to oncotator version 1.9.2 and oncotator_v1_ds_April052016 database. The tool got installed properly and is running fine without any error. But, the output is strange as I am not getting the expected annotations.
Following is my input:

chr7    55259515    55259516    T   G

and this is the output:

EGFR    1956    __UNKNOWN__ __UNKNOWN__ 7   55259515    55259516    __UNKNOWN__ Silent  SNP T   T   G   rs397517129     __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ __UNKNOWN__ g.chr7:55259515T>G  ENST00000455089.1   +   20  2695_2696   c.2438T>G   c.(2437-2439)cT>cG  p.813del    EGFR_ENST00000454757.2_Silent_p.805del|EGFR_ENST00000442591.1_Intron|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000275493.2_Silent_p.858del          P00533  EGFR_HUMAN  epidermal growth factor receptor    858 Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.                activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412) apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)  actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)  p.L858R(2265)|p.L858L(1)|p.L858Q(1)|p.L858K(1)      NS(342)|adrenal_gland(268)|autonomic_ganglia(313)|biliary_tract(590)|bone(272)|breast(3441)|central_nervous_system(1908)|cervix(310)|endometrium(327)|eye(148)|fallopian_tube(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(1287)|kidney(777)|large_intestine(4199)|liver(484)|lung(83420)|meninges(69)|oesophagus(1596)|ovary(1049)|pancreas(804)|parathyroid(5)|penis(29)|peritoneum(132)|pituitary(50)|pleura(286)|prostate(603)|salivary_gland(552)|skin(1352)|small_intestine(83)|soft_tissue(855)|stomach(1049)|testis(82)|thymus(337)|thyroid(915)|upper_aerodigestive_tract(2706)|urinary_tract(336)|vagina(1)|vulva(79) 111060  all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)      GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)       Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)  GATTTTGGGCTGGCCAAACTGC  0.540   L858R(NCIH1975_LUNG)    8   """A, O, Mis"""     """glioma, NSCLC""" NSCLC           Lung Cancer, Familial Clustering of TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)                                                                                                               yes Dom yes Familial lung cancer    7   7p12.3-p12.1    1956    """epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""        """E, O"""      2268    Substitution - Missense(2267)|Substitution - coding silent(1)   lung(2236)|breast(12)|thyroid(6)|upper_aerodigestive_tract(6)|large_intestine(2)|stomach(1)|thymus(1)|peritoneum(1)|biliary_tract(1)|ovary(1)|prostate(1)                       SO:0001819  synonymous_variant                                                                                                                                                                                                                                                                                                                                                                                              Familial Cancer Database    incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer     CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1 7p12    2014-09-17  2010-06-25      ENSG00000146648 ENSG00000146648         3236    protein-coding gene gene with protein product   """erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""  131550  """epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)""" ERBB        1505215 Standard    NM_201282       Approved    ERBB1   uc003tqk.3  P00533  OTTHUMG00000023661  ENST00000455089.1:c.2438T>G chr7.hg19:g.55259515T>G         O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5  ENST00000455089.1   hg19                                                                                                                                                                                                                                                                                                                                                    EGFR-004    PUTATIVE    basic|exp_conf  protein_coding  protein_coding  OTTHUMT00000343056.1    NM_005228   

As you can see, the input is well known EGFR L858R mutation but the output is showing p.813del. I am not able to understand what is going wrong here. Can you please help me troubleshoot this error.

Thanking you.
Best,
Pratik

Issue · Github
by Sheila

Issue Number
2226
State
open
Last Updated
Milestone
Array

Best Answer

Answers

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @pratikchandrani
    Hi Pratik,

    I will ask our Oncotator expert @LeeTL1220 to get back to you.

    -Sheila

  • LeeTL1220LeeTL1220 Arlington, MAMember, Broadie, Dev ✭✭✭

    @pratikchandrani One more thing: You may get a protein annotation that is still centered at 813. Please note that this is not an error, but that there are different transcripts and oncotator is not choosing the one you desire. Are you using the transcript override file? If not, please do -- most issues like this are fixed doing that. If you are using a transcript override file, you can always add ENST00000275493.2 to that file and you will get the EGFR annotations that you want.

  • pratikchandranipratikchandrani IndiaMember

    Thank you @Sheila and @LeeTL1220
    I have found the error in our oncotator input file generation script and have corrected it (chr7 55259515 55259515 T G instead of chr7 55259515 55259516 T G).
    I have also noticed alternative transcript based annotations which will be helpful to select best transcript per gene/mutation.
    Once again thanks for quick response.

    Best
    Pratik

Sign In or Register to comment.