Heads up:
We’re moving the GATK website, docs and forum to a new platform. Read the full story and breakdown of key changes on this blog.
Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Mutect2 output not match to real situation

mscjuliamscjulia United StatesMember

Hello,

I used Mutect2 to call variants on a pair of tumor and normal samples. One variant "PASS" the filter is shown below:

4   6956086 .   C   CTTTCTTGCT  .   PASS    ECNT=1;HCNT=34;MAX_ED=.;MIN_ED=.;NLOD=54.49;RPA=1,2;RU=TTTCTTGCT;STR;TLOD=17.08 GT:AD:AF:ALT_F1R2:ALT_F2R1:FOXOG:QSS:REF_F1R2:REF_F2R1  0/0:543,19:4.673e-03:0:0:.:9520,0:163:122

To my limited understanding of Mutect2 output, I think passing the filter means that "CTTTCTTGCT" is in tumor, not normal. I am trying to locate this small insertion event, and I attached an screenshot of the BQSR bam file, with the variant in the middle of the sequence. Here is one read I got from the tumor sample's sam file. Overall, there is a C to T mutation, which also occurs in the normal sample (not shown), but I do not see this insertion when comparing to the reference

ST-E00545:65:HJLYWALXX:7:1221:18061:39844       83      4       6956047 60     150M     =       6955995 -202    CGCTCCTGTTCATGGACAGGTTTGTGGCTGCTTTCTTGCTTTTCTTGCTGTTGGAACTGGAGACTTAACTGGAAGCAGAGTCTTTCCTGCGTGTAGCTTTGACAGCATGTGACCGTCGGCCTTGGTTGGGCTGAGGTGTTTCTGTGGGTC  JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA  NM:i:1  MD:Z:39C110     AS:i:145        XS:i:22 RG:Z:032017

The reference around chr4 6956096 is "CTTTCTTGCCTTTCTTGCT".

I am new to Mutect2 so I want to confirm with you experts about this. I understand that MuTect2 is still in beta testing stage, but I would really appreciate your advice. Thanks a lot!

Tagged:

Answers

Sign In or Register to comment.