If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra

Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Error running CollectAlignmentSummaryMetrics on a bam generated from .maf file

Recently I run an alignment with LAST tool ( - fasta aligner for long reads alignment), it produces .maf file which I then converted to sam(with then to bam (with picard). Until now everything looks fine, next I try to run picard CollectAlignmentSummaryMetrics and it throws this error:

Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 0
at picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector$IndividualAlignmentSummaryMetricsCollector.collectQualityData(
at picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector$IndividualAlignmentSummaryMetricsCollector.addRecord(
at picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector.acceptRecord(
at picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector.acceptRecord(
at picard.metrics.MultiLevelCollector$AllReadsDistributor.acceptRecord(
at picard.metrics.MultiLevelCollector.acceptRecord(
at picard.analysis.AlignmentSummaryMetricsCollector.acceptRecord(
at picard.analysis.CollectAlignmentSummaryMetrics.acceptRead(
at picard.analysis.SinglePassSamProgram.makeItSo(
at picard.analysis.SinglePassSamProgram.doWork(
at picard.cmdline.CommandLineProgram.instanceMain(
at picard.cmdline.PicardCommandLine.instanceMain(
at picard.cmdline.PicardCommandLine.main(

I am adding the head of the bam file:

0034a196-edbc-429f-89c4-b5280a486760_Basecall_2D_2d 0 burn-in 1 100 4H21=1D18=.....1D17=2D1X6=6D1X11=2I1X31=19H * 0 0 GGGCGGCGACCTCGCGGGT.....AGCATGCCACG * NM:i:152 AS:i:10909
06c0ff36-09df-4bb3-b952-146fca6f60ae_Basecall_2D_2d 0 burn-in 1 100 8H21=1D3=......2D1=1I57=2D68=1D1=2D42=29H * 0 0 GGGCGGCGACCTCGCGGG...........GCAAGCGTGA * NM:i:402 AS:i:33419

I deleted values in the middle of SEQ and CIGAR strings because they are very long.

Running ValidateSamFile on this bam file shows not relevant problem:

HISTOGRAM java.lang.String

Error Type Count

For the same sequencing run I had fastq files which I aligned with bwa and when I run CollectAlignmentSummaryMetrics on the bam file from this workflow it worked fine. here is a head of the bam from this workflow (alignment with bwa using fastq):

0034a196-edbc-429f-89c4-b5280a486760_Basecall_2D_2d 0 burn-in 1 60 4S18M1D1....M6D32M19S * 0 0 TGCTGG...TGTTTGA /)6-,(-.../9/)0,*, MD:Z:18^T..A11G31 NM:i:138 AS:i:1920 XS:i:0
06c0ff36-09df-4bb3-b952-146fca6f60ae_Basecall_2D_2d 0 burn-in 1 60 8S18M1D1...D1M2D42M29S * 0 0 GTATTGC...ATGTGTTTC =.01-)**)./....'-.+*+ MD:Z:18^.^A1^AA42 NM:i:371 AS:i:5836 XS:i:0

Same as before, I removed the characters in the middle of the long strings.

Hope you could help me with my problems.

Thanks and have a great day.


Best Answer


  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin
    The ArrayIndexOutOfBoundsException error suggests that you may have some malformed reads where the alignment information does not make sense, e.g. Maps off the end of a contig or something like that. That could be a bug in the aligner you're using. This seems especially likely considering the BWA alignment appears to be healthy.
    edited December 2016

    Well it seems that the only difference between the two bam files (one from aligning with fastq and one from aligning with fasta, two example sequences from the files are posted in the first post) is that in one file there is a phred score and in the other file there is a single "*" in that place.
    I'm trying to figure how to work with that but if anybody have a suggestion I will try it.

    BTW, I'm using the latest version of picard (2.8.1)

  • shleeshlee CambridgeMember, Broadie ✭✭✭✭✭

    Hi @SDFfASF,

    If what you post is indeed the top of the BAM file, then you are missing an actual header. Also, your error messages are saying that the BAM is missing read group information, which also indicates a missing header.

    To start, take a look at this FAQ to see what a BAM header should look like. To add such a header, e.g. you can use Picard's ReplaceSamHeader.

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin
    I'm pretty sure the problem is because of that asterisk. What program generated your alignments?

    @shlee It had a header I just didn't post it by mistake. I will read the faq for sure, thanks.

    @Geraldine_VdAuwera I'm pretty sure too and when I put a some phred values instead of this asterisk picard worked fine. But I thought i saw somewhere in the documentation that picard did not requier qscore in the bam/sam and could work with files where it's replaced with a "*". The tool was last, i linked to it in the first post.

    Issue · Github
    by Sheila

    Issue Number
    Last Updated
    Closed By
  • shleeshlee CambridgeMember, Broadie ✭✭✭✭✭
    edited January 2017


    Thanks for the feedback. I examined your two sets of records carefully and notice one interesting difference. The first set (that gives you problems with CollectAlignmentSummaryMetrics) uses extended CIGAR nomenclature (1D17=2D1X6=6D1X11=2I1X31=19H), while the second set (that works fine) does not (M6D32M19S). Would it be possible for you to attach a file of 100 such extended CIGAR SAM records in a valid BAM file, i.e. with header, so that we can test whether this is the problem or if something else is causing the issue? Can you make sure this snippet still gives you the error before attaching it here in this thread? Thanks.

    edited January 2017

    Lately, I'm using another tool that had similar problems with it's output with picard. Though it didn't use extended CIGAR and still had the problem with the asterisk, so I will post some test file snippets from this tool's output. I attached files which were originally .sam files but I changed it to .txt in order to upload.

    Important to note: picard throws "Error parsing SAM header. @RG line missing SM tag" with those files but I read that this SM tag is not essential for picard and u can ignore this error by adding "VALIDATION_STRINGENCY=SILENT" which I did.

    First file [testWithAsterisk.txt] - Original sam file which had asterisk instead of qscore:
    @HD VN:1.0 SO:unsorted
    @SQ SN:burn-in LN:48502
    @RG ID:1
    @PG ID:6 PN:minialign
    8915e658-528c-4677-88a8-c2eba6c58fc5_Basecall_2D_template 4 * 0 0 * * 0 0 TTGGCAGATAACATATTTTATCTTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGG * RG:Z:1

    And the command and error it produced: (it didnt output any file)

    $ java -jar ~/tools/picard.jar CollectAlignmentSummaryMetrics R=../LambdaRefGenome.fa I=test2.sam O=testSummary4.txt VALIDATION_STRINGENCY=SILENT
    [Sun Jan 15 10:53:12 IST 2017] Executing as [email protected] on Linux 2.6.32-642.1.1.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_66-b17; Picard version: 2.8.1-SNAPSHOT
    WARNING 2017-01-15 10:53:12 SinglePassSamProgram File reports sort order 'unsorted', assuming it's coordinate sorted anyway.
    [Sun Jan 15 10:53:12 IST 2017] picard.analysis.CollectAlignmentSummaryMetrics done. Elapsed time: 0.00 minutes.
    To get help, see
    Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 0
    at picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector$IndividualAlignmentSummaryMetricsCollector.collectQualityData(
    at picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector$IndividualAlignmentSummaryMetricsCollector.addRecord(
    at picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector.acceptRecord(
    at picard.analysis.AlignmentSummaryMetricsCollector$GroupAlignmentSummaryMetricsPerUnitMetricCollector.acceptRecord(
    at picard.metrics.MultiLevelCollector$AllReadsDistributor.acceptRecord(
    at picard.metrics.MultiLevelCollector.acceptRecord(
    at picard.analysis.AlignmentSummaryMetricsCollector.acceptRecord(
    at picard.analysis.CollectAlignmentSummaryMetrics.acceptRead(
    at picard.analysis.SinglePassSamProgram.makeItSo(
    at picard.analysis.SinglePassSamProgram.doWork(
    at picard.cmdline.CommandLineProgram.instanceMain(
    at picard.cmdline.PicardCommandLine.instanceMain(
    at picard.cmdline.PicardCommandLine.main(

    Now the second file [testWithQscore.txt] - with the only thing changed is added (fake) qscore values instead of the asterisk:
    @HD VN:1.0 SO:unsorted
    @SQ SN:burn-in LN:48502
    @RG ID:1
    @PG ID:6 PN:minialign
    8915e658-528c-4677-88a8-c2eba6c58fc5_Basecall_2D_2d 16 burn-in 41435 60 31M4D6M2I4M2D11M1D4M1D33M1I1M2D13M1D26M3D4M1D61M2D13M1D11M2D3M1D13M1D1M1D7M1D15M1D10M1D2M2D6M1I3M1D4M1D22M1D31M1D3M1D7M5D10M2D22M1I2M1D16M1I14M1I17M2D12M2I7M1D36M2I2M1D19M1D35M1D39M1D21M1D5M1I78M3D14M2I13M1D8M2D18M2D78M1I11M1I3M2D1M2D2M1I5M1I8M1I36M1D12M1D19M2D10M1I1M1I13M3D7M1D20M1D53M1I27M1I37M1I9M2D139M1I7M2D22M1I19M4D50M1D108M2D26M1I37M2I34M2I9M1I6M1D62M2I11M1I28M1I5M2D49M1D25M1D19M1I10M1D57M1D15M1D17M2I8M1D34M1D15M2D12M1D56M2D9M2I3M4D27M3D12M1D10M1D59M1D29M1D16M2D72M3D8M1D77M1D8M6S * 0 0 CCCTTCACCAAATACTGTGATGAATATATCAAGGGAAAATTACCACGTGGATTGCATCGAGCCGATAAACTGAAGCGGCTAAAGCCAAAGCACGAATCAGATATCTGAAGAACTGTCAGACTTTGAGAAGGATATCTCGCATGGTGGAAGCAATAACCATTCGATTTGCAAATACCGGAACATCTCGGTAACTGCATTCTGCATTAAAAATCAACGCAAAATCGACTTGCCTGCAAAAGAGGAGGATTGCAGCGTGTTTTAATGAGGTCACAGGATCCGCAATGCGGACGGACATCGGGAAACGCCAAGGAGATTATGTACCGAGGAAGAATGTCGCTGACGTATCGCGGTATTCAGAATGATTATCAAGCCCTGTATCAGAGAAGGGTACGAGCTAAAAAGATTCGATACTGGTATTTTGTTCTGAGTCATGAAATACTTGGAGAGGGCAGCTGATTTTGACTTCGGGAGGGAAGCTGCATGATGGGATAAGCATCGGTGCGGTGAATGCAAGAAGATAACCGCTTCCGACCCAATCAACCTTACTGAATCGATGGGGTCTCCGGTGTGAAAGAACACCAACAGGGTGTTACCACTACCGCAGGAAAGGAGGGACGTGTGGCGAGACAGCGACGAAGTATCACCGACATAATCTGCGAAAACTGCAAATACCTTCCAACGAAACGCACCAGTAAACCCAAGCCAACTTGCAAAAAGAATCGACGTAAACCTTCAACTACACGGCTCCTGTGGGATATCCAGTGGCTAAGACGTCGTGCGAGGAAAACAAGGTGATTGACCAAAATCGAAGTTACGAACAAGAAAAGCGTTGAGCAAAGCTAGTCGCGCTTAACTGCGTATTAAAAGCTGCATGTGCTGGAAGTTCACGTGTGTAACACTGCTGCGGAAACTGATGAGCGATCCGAAGCCTGATGCATCAGAGGAAGAAGATGGATAAACAGCGCGAAGACGATGTAAAACGATGAATGCCGGGAATGGTTTCACCCTGCATTCGCTAATCAGTGGTGTTAATACTCCAGAGTGTGGAACCAAGATAGCACCTCGAACGACGAAGTAAAGAACGCGAAAAAGCGGAAAACAGTAGCAGAAGAAACGACGACGAGAGGAGCAGAAACAGAAAGATAAACTTAAGATTCGAAAACTCGCCTTAAAGCCCCGCAGTTACTGGATTAAATAAGCCCAACAAGCTGCAAACGCCTTCATCAGAGAAAGAGACCGCGACTTTCCCATGTATCGTGCGGAACGCTCACGTCTGTTTCAGTGGGATGCCGGACATTGACAACTGCTGCGGCACCTCAACTCCGATTTAATGAACGCAATATTCACAGCAATGCGTGGTGTGCAACCAGCACAAAAGCGGAAATCTCGTTCCGTATCGCGTCGAACTGATTAGCCGCATCGGGCAGGAAGCAGTAGACGAAATCGAATCAAACCAACCGCCATCGCTGGACTATCGAAGAGGTGCAAGGCGATCAAGGCAGAGTACCAACAGAAACTCATAAAGACCTGCGAAATAGTAGAAGTGAGGCCGCATGGGACGTTCTCTTGTAAAACCATTCCAGACATGCTCGTTGAAACATACGGAAATCAGACAGAAGTAGCACGCGGACTGAAAGTTGTAGTCGCGGGTACGGTCAGAAAATACGTTGATGATAAAAGATGGAAATGCACGCCATCGTCAACGACGTTCTCATGGTTCATCGCGGATGGAGGAAAGAGATGCGCTATTACGAAAAATTGATGGCGGCAAATACCGGAAATATTTGGTAGTTAAGGATCTGCACGGATGCTACACGAACCTGATGAACAAACTGGATACGATTGATTCGACAACAAAAAGACCTGCTTATCTCGGTAAGGACGGCTGGTTGATCGTGGTGTAGAGAACGTTGAATGTTTGAATTAATCACATTCCTGGTTCAGAGCTTGCATGGAAACCATGAGCAAATGATGATTGATGGCTTATCAGAGCGTGGAAACGTGTCACTGGCTTAGCTGGCGGTGGCTGGTTCTTTAATCTCGATGACAAAGAAATTTGGCTAAAGCCTTGCCCATAAAGCAGATGAACTTCCGTTAATCATCGAACTGGTGAGCAAAGATAAAAATATGTTATCTGCCACGCCGATTATCCCTTGACGAATACGAGTTTGAAGCCAGTTGATCATCAGCAGGTAATCTGGAACCGCGAACGAATCAGCAACTCGCGCCGTGGGATCGTGAAAATCAAAGTGCGGACACGTTCATCTTTGGTCATACGCCAGCAGTGAAACCACTCAAGTTTGCCAACCAAATGCATATCGATACCATGCAGTGTTGCAAAA 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111 RG:Z:1
    8915e658-528c-4677-88a8-c2eba6c58fc5_Basecall_2D_template 4 * 0 0 * * 0 0 TTGGCAGATAACATATTTTATCTTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGG 1111111111111111111111111111111111111111111111111111111111111111111111 RG:Z:1
    8da715a9-3717-4f04-9667-e7e0c2792104_Basecall_2D_2d 16 burn-in 9431 60 27M4D17M2D15M1D5M1D7M1D9M1I27M1D17M2D8M6I7M3D2M1D1M1D9M2D27M4D9M3D18M2D18M6D15M1D36M1I9M1D4M1I1M3D20M2D16M2D3M1D7M1D8M1D7M3D4M1D11M1D24M1D37M2D9M1D15M1I16M1I9M1I9M1D29M2D5M1D3M1D11M2I5M3D1M1D4M6D5M2I4M4I5M1I10M1D8M2D6M2I16M1D18M5D4M5I4M1D22M2D2M1D6M1D5M1D9M1I4M1D2M2D15M2D6M1I1M3I6M3D11M1D16M1D23M5D9M4D3M2D1M1D3M1I8M2D15M1D8M3I14M1D7M1D1M1D7M1D9M5D2M2D4M1D9M1D3M1D24M2D11M1D7M2D26M6D7M1D3M1D6M1I14M3D12M3D3M1I19M1D9M1D7M1D4M1I1M3D29M1I3M1D13M2D1M1D23M2D18M1D10M1D7M2D13M1D4M2D3M1D7M1D8M1D11M1D4M2D2M3I3M1D17M3I3M1I5M3D12M1D4M2D15M1D7M2D3M3D8M2D4M4D8M1D11M1D18M1D27M2I23M4I1M1I5M2D3M3D23M1D53M2D3M1D3M4D8M2D13M1D33M4D5M1I7M1D2M1D2M1I5M2D7M1D15M1D8M2D9M1I17M4D12M2D20M1I7M2I16M1D1M1D2M1D5M1D2M1I9M2I14M3I4M1D6M4D4M5I3M1D14M2D10M1D1M2D19M2D6M1D15M1D23M6D4M2I5M1I1M2D15M1D10M2I3M1D3M1D54M1D11M1D44M2D3M3D18M1D25M1I9M1D5M1I4M2D3M2D17M1D10M3D9M1I13M2D18M2D2M1I15M1D3M1I9M5D4M1D2M1I9M2I1M1I2M1I5M1I25M2D8M1D28M1D14M1I6M2I7M1I21M4D33M1D3M1D1M4D4M1D3M2D18M1D4M1D3M1D11M1D1M2D5M2D7M2D21M2D3M5I4M2D7M2D7M1D71M1I14M4D5M1I9M1D23M1D13M2D22M1D38M3I7M1I8M1I13M1I2M3I14M3D7M2I36M4D13M1I9M1D7M1D4M1D6M1D4M1D8M1D2M1D2M1I10M2D5M1D13M1D28M4D5M2D18M3I5M4I6M4I3M2I10M1D9M1D16M1I4M2D5M6S * 0 0 AGCGGCAACCGGCATGACCGTGACGCCAGCACCTCGGTGGTGAAGGCAGAGTACCACGCGACGGGGCCTTCAGCCGGAGGCGCGTAAACGACAAGAGCTTTCGTGCAGGTCTGCGGACAAAACAAGCCACCGTCGGCTTGTCGGTCGGAGACTATCACTGAACGGCGTTGCTGCAGGCCGGGTTATCCGGTGCTCGGTAATGGTGAGTTTGCCGGTTGCAGAAATTACCGCCAGTTAATCCGGAGGTCGACGATGTTCTTAGAAACCGAATCATTTGAACACTAACGTGGTACTGCTGCTTTCTGAACTGTCAGCCCCAGTGCATTGAGCATCGCCTGATGAACGGCGTGCGAACAGGAGTCGACAGCAACCGAAGTTTGCTGTGGAAGATGCCATCGAACCGGCGCGTTTCTGGTGGCGATGTCCCTGTGGCAACCATCCGCGAAGACGCAGATGCCAGTCCATGAATGAAGCCAGTTAAACAGGATTGAGCAGAAGTGCTACCCACCTGGCCGGCGCGCGCATTCACTACGAAAACGTAAAACGCACCTTCTGATGCGCCTTCGCGGATGGTGGAATAATGCCTTGAACAGAGAGGACACGCCGGGCCCGCAAAGCTGAAGCTGCGGGAAAGTGCGGTCATGCGAGCGAGTTTCGCCCTGAAACTGGCGTGGATGGGCGACCGACTGAAAAAGCCAGCGGCTGGAGGTCATCCGGAGTGGTACCGCCGACCACCGCTTTTGAGCACCCATTATTTTCTGATGTTCTGCTGGATATGCACTGGGCTGACGCCGCCATACCTGTTTTAGCGATCCGGATATGATCCGCCGACGGATTTCAGTCTGCCAATGGGCCAGGCTGAGAAGGTTCTTGGGGCGATGCTGCAGCGCAGGGCTTGCCGGAGGTGTCCGCCGGCCCGGACGAAATGAAGACCCCCGCTTCCCAGGATGTGGCGAAGGAGGACACGAATGCCAGATGACAGCATCATGGACTGCAGGAGTCCAGGTATGGCTGGTCCGGTAGCGATTTAATGTTGATTGAGTTCACGCGCTTGGATTTGACGAACAGATGGCGTAGATCAGGCGTCATTTCGGTACGGAAAGTGATGCGAAAAACAGCGGCAGTCGTTGACCGTCGCCGAGCGACAGGCTGGCTGCACAGAAGCGGATTCCGTCGGCGGTAGAAGCCGCCATGCGAGGCCCGGGTGCCGGTTCACCGACGTGGCTGGCCCTGCAGCCAGGGTGGCAAATCCGGCTGATCCTGCCGCACAGGGGGCAGAAGGACTCTCAAATGATCCCATGTTCAGGGGCTTGCCGGTGCGATCACCTGCCGATGGTGGGGGCCACCTCGCTGGTGCGGTGGCGACCGGTGCGCTGGCGGCGCTCATGCCGTAGGGCAACTCAACCCCGTCCGATTCAACAAAACGCTGGTCCTTTCCGGCAATCAGGCGGGACTGACGGCAGATCGTACTGTCCCAGAGCCGCAGGCGGCAGGGCGACGTTTAACCAGACCAGCGAGTCACTCAGCGCGTTAGCGGCGGGGTAGCAGGTGACTCGGGTGCGTCCATCAGCGAGGTGTGGCGTTTCTCTTCCTGCATCCGGCGTGGAGGCAAGGTCGCTGACCTTCCGGAAGCTGACCAGAAGACCCGAGCCGTCAGGGCTGACGGCAGGTCGCGGTGTCCGCAAGGCATGTCGGCGGAGCAGCGGACAGGTATGTCAGAAGCGGTGCGCGTTCCAGCGATGGCCGGGCGATGGGCGGCAGCCGAGGCCGCAGTCAGGTTTGATGACCAGACCGCCGCCTGAAAAAGAACATGGGCGAAAAACCTGGTGGACAGGACTGCGCGGCATTCAAATCAGCAATGGATGCGGTGCTGGATATTGGTCGTCCTGATACCGCGCAGGAGATGCTGATTACGTAGAGGCTGCGGTAAGAAAGCAGACGACATCTGGAATCTGCGCAAGGATGATTATTGTTGATGAAGCGCGGGCGCGTACTGGGATAATCGTGAAAAGGCCCGGTCTTGTGCCGAAGTTCGCCAAAAGGCTGAGCAGCAGACTACCAGGACAATGCGCCGTATGGTGAGCAATACCAGCGTCACGGCTGAAACACCAGAAAGGGCGCAAAAGCTACACGAACAGCACGGGCATGCCGAAAGCGAGTAGCCGCCGCATCAGGAAGAACTGAACAAAACACAAAGACGGAAAATCCTGCAGGCGGATTACAACGCGCGATGGCAGAAGTAAGAAAAGGCGATTATGGCAGCGAGCCGGCGTCGGCTGAATCCAGCGTGAAGGTGTCTGCGGGCGATCGTCAGAAGCCTCAGCTCTTGCCGATGCTTCAGGTGAACCCGACGCCGGAAAACGCCGGCAAATGAAAATCAGCCAGCAGCGCCGGGTTGCCAGGTGGTGCGGAGCCAGCTCAGGTACTGGAGGAGGCGGCGCAACGTCGCCAGCTGTCCGGGCACGAGAAAATCCTGCCGGCGCATAAAGATGGAGACGCTTCATTATGCTATTCTGGCTGCATCGGCGACAAGGTTACGTATCAGAGCGCTTGAACGCTGGCGCAGCAGGCGGATAAATTGCACAGCAGCAACGGTGAAAACGGGCCGCCACTGATGTAGAGAGAAACTCGTGCGCCAGACTGACCAGCAGTGCGGTAGACCGGGAAGCCAAACCGGGTGCCTGAAGGAACAGTATGGCGATAATCTGCTGGCGCCAACGTCATGTCAGGAGCAGAAAAGATCAGGCAGCGAGCACAGCTCGCGGGAATGATAGGCAGGCCCGGTCCGCTGGAGTGAGTGGAAGAGAGCGCCAATGACAGCATGTCGCAAAAAGCAGCCATGCAGACCTTTGGTGATGGTGTGCATTGCAGGTGCGGTGAATATGGCGTGATGCTGACGGCAGTGAGCAGAACTTGGCGGCTTCTGTTCC 11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111 RG:Z:1

    And the command for this one is: (it produced a normal AlignmentSummaryMetrics file)

    $ java -jar ~/tools/picard.jar CollectAlignmentSummaryMetrics R=../LambdaRefGenome.fa I=test.sam O=testSummary2.txt VALIDATION_STRINGENCY=SILENT
    [Sun Jan 15 10:53:01 IST 2017] Executing as [email protected] on Linux 2.6.32-642.1.1.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_66-b17; Picard version: 2.8.1-SNAPSHOT
    WARNING 2017-01-15 10:53:01 SinglePassSamProgram File reports sort order 'unsorted', assuming it's coordinate sorted anyway.
    [Sun Jan 15 10:53:01 IST 2017] picard.analysis.CollectAlignmentSummaryMetrics done. Elapsed time: 0.00 minutes.

    Hope this helps.


  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Hi @SDFfASF,

    I can confirm it's the asterisk that causes a problem. The error stack trace shows that this is the function that's choking on your read:


    This function looks up the quality scores by the index position of the corresponding base, so if the array is just a single asterisk, the function will error out for any base after the first. That's why you get an ArrayIndexOutOfBounds as explained here.

    The tricky thing is that many Picard tools have requirements that are different from the majority of tools and are often not documented. The metrics collection tools tend to have the most exhaustive requirements for records being complete, because they access most if not all of the properties of the data. We'll try to document these things more clearly in future.


    OK, thanks @Geraldine_VdAuwera that clears up a whole lot of confusion. Now I believe that collect summary metrics require the qscore values in order to calculate few metrics "for high quality bases" but can I somehow turn this option off so picard could collect all other metrics not related to quality? OR can I ask picard to assume all bases have the same qscore?

    If there is no solution on picard's end I guess I would need to either loop over each read in the sam file and to "fake" qscore values of the same length of the read or (what might be more troublesome to write) for each read go to the original fastq file and place the qscore values from the fastq to the corresponding bases for this read in the sam file.

  • elcinchu27elcinchu27 BroadMember, Broadie
    edited March 2017

    Hello @Geraldine_VdAuwera

    I am not sure but I think that I have the "asterisk problem" with CollectMultipleMetrics in the "MutationCalling_QC_v1-1_BETA_cfg" pipeline:

    -INFO 2017-03-09 17:42:01 SinglePassSamProgram Processed 104,000,000 records. Elapsed time: 00:28:44s. Time for last 1,000,000: 15s. Last read position: X:153,045,203
    -[Thu Mar 09 17:42:10 UTC 2017] picard.analysis.CollectMultipleMetrics done. Elapsed time: 30.98 minutes.
    -To get help, see Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 287

    I am not sure if this is the problem or not because other people who launch the same analysis with non-mapped reads didn't have this kind of error. The picard version is 2.1.0 and the symbol for this type of reads is " * / * ". Do you know if I could do something to fix it?

    Thank you for the help,

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Hi @elcinchu27, if your data doesn't have qscores you need to add a flat default; see my "accepted" answer at the top of the thread.

  • elcinchu27elcinchu27 BroadMember, Broadie

    Hello again @Geraldine_VdAuwera,

    As you said, I tried to add flat default values for the qscores but unfortunately I still have the same problem with the pipeline:

    java -jar /usr/local/bin/GenomeAnalysisTK.jar \
    -T PrintReads \
    -R reference.genome \
    -I input_bam \
    -DBQ 0 \
    -o qscores.bam

    I wrote "-DBQ 0" because the default value is -1, and there is an error message that said that it is no possible to use negative values. Do you have any idea about the problem? Thanks for the help.

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    The default -1 value is a special-cased value that disables the use of default quals. I'm not sure about 0 but that might be special-cased too. I would recommend using a more realistic qual value, like 20 or 30 instead.

    That being said I don't know whether this will actually solve your problem; I'm assuming that your problem is the same as the original poster's, but if it's a different problem then this won't be sufficient. Did you run ValidateSamFile on this data?

  • elcinchu27elcinchu27 BroadMember, Broadie

    Yes, I looked for errors and warnings but the output shows "No errors found":

    /usr/lib/jvm/java-1.8.0-openjdk-amd64/bin/java -Xmx2g -jar /opt/picard-tools/picard.jar ValidateSamFile \
    I=input_bam \
    OUTPUT=output_errors.list \

    /usr/lib/jvm/java-1.8.0-openjdk-amd64/bin/java -Xmx2g -jar /opt/picard-tools/picard.jar ValidateSamFile \
    I=input_bam \
    OUTPUT=$output_warnings_errors.list \

    I could try the same with those other values and see if it works or not.

  • elcinchu27elcinchu27 BroadMember, Broadie
    edited March 2017

    I just checked the input and output files of "PrintReads" with "-DBQ 20" and I don't see any difference between them, because the asterisk is still in the new bam generated by the program. I don´t know why there is no change between both files.

    1) input.bam:

    PG:Z:MarkDuplicates RG:Z:1271ND
    @DDDBDBF<;FF?G::@FG>;[email protected]?)00B* B*/9)/)8==BCG;;FH############################

    2) qscores.bam:
    PG:Z:MarkDuplicates RG:Z:1271ND
    @DDDBDBF<;FF?G::@FG>;[email protected]?)00B* B*/9)/)8==BCG;;FH############################

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Ah, I think I was partly wrong and the -DBQ argument only injects base quals for on the fly computation, but the values aren't actually replaced in the sam records.

    More to the point though, it looks like your reads do have base qualities. I thought from your original post that they didn't -- that was the original poster's problem. So your problem is actually that you're missing mapping qualities. I'm not up to speed on all the requirements of CollectMultipleMetrics but I wouldn't be surprised if it also required mapping qualities. This brings us back to my recommendation to ask the authors of the pipeline to state the data requirements for the pipeline to work.

Sign In or Register to comment.