We've moved!
This site is now read-only. You can find our new documentation site and support forum for posting questions here.
Be sure to read our welcome blog!

gVCF ALT Allele "*"

dmb107dmb107 MIamiMember
edited May 2016 in Ask the GATK team


I have noticed that most of my alternate alleles are followed by a "*" allele. In the following example, the GT is 0/6 which seems to correspond to REF/*.

For example:
TTGCATGGTGCCGTGA,GCGGACCCTGTTGGAGGAGGCTGGGTGGTTGCATGGTGCCGTGA,GACCGGACCCTGTTGGAGGAGGCTGGGTGGTTGCATGGTGCCGTGA,* 182245.29 GT:AD:DP:GQ:PL 0/6:840,0,0,0,0,0,73:917:99:170,2590,35627,2590,35627,35627,2590,35627,35627,35627,2590,35627,35627,35627,35627,2590,35627,35627,35627,35627,35627,0,33783,33783,33783,33783,33783,34747

How do I interpret these * alleles?

Thank you.

Post edited by dmb107 on

Best Answer


Sign In or Register to comment.