Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Picard MarkDuplicates string did not start with a parseable number

ryanfriedman22ryanfriedman22 Washington University in St. LouisMember

I'm running RNA-seq data through the GATK Pipeline for RNA-seq variant calling and am getting an AbstractOpticalDuplicateFinderCommandLineProgram Warning while running MarkDuplicates with the message

A field field parsed out of a read name was expected to contain an integer and did not. Read name: C1n.EXACT.TTAT.13482648. Cause: String 'C1n.EXACT.TTAT.13482648' did not start with a parsable number.

I'm not quite sure how this is the case, since when I run the command

samtools view rg_added_sorted.bam | grep C1n.EXACT.TTAT.13482648

the output is:

C1n.EXACT.TTAT.13482648 16 chr1 5196 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:1 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr3 1813 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:3 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr3 9145 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:4 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr4 1347 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:6 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr10 691 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:7 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 256 chr10 1054683 0 32M * 0 0 CCTCTGATGAACTCCAAGCTGTTCATCTCGAA * RG:Z:id NH:i:7 HI:i:2 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr11 1443 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:5 nM:i:0 AS:i:31

I'm running the following command as a part of a job on a SLURM cluster using JVM build 25.31-b07, mixed mode

java -Xmx8G -Xms8G -jar $PICARD_HOME/picard.jar MarkDuplicates I=rg_added_sorted.bam O=dedupped.bam CREATE_INDEX=true VALIDATION_STRINGENCY=SILENT M=output.metrics

There's no stack trace since it's just a warning, but it causes problems later when I run SplitNCigarReads, saying it's malformed.

Best Answer

Answers

Sign In or Register to comment.