Heads up:
We’re moving the GATK website, docs and forum to a new platform. Read the full story and breakdown of key changes on this blog.
Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.
Attention:
We will be out of the office for a Broad Institute event from Dec 10th to Dec 11th 2019. We will be back to monitor the GATK forum on Dec 12th 2019. In the meantime we encourage you to help out other community members with their queries.
Thank you for your patience!

out.interval is empty with RealignerTargetCreator.

chiragchirag University of MacauMember
edited July 2015 in Ask the GATK team

Hi,

I am running GATK for mouse variation analysis. I am trying to do indel realignment using RealignerTargetCreator. Program run successfully but there is no data in put.interval file

**********command **********

java -Xmx5g -Xms5g -Djava.io.tmpdir=`pwd`/tmp -jar /share/apps/gatk/src/GenomeAnalysisTK.jar \
 -nt 36\
 -T RealignerTargetCreator \
  -R mm_ref_GRCm38.p2_Genome_renamed_reordered.fa \
  -o out.intervals \
   -known:myvcf,VCF /home/cparsania/Database/mm_ref_GRCm38.p2/mgp.v5.merged.snps_all.dbSNP142_renamed_sorted.vcf 

**********Output Log**********

INFO  16:07:22,948 HelpFormatter - Executing as [email protected] on Linux 2.6.18-308.el5 amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_25-b17. 
INFO  16:07:22,948 HelpFormatter - Date/Time: 2015/07/15 16:07:22 
INFO  16:07:22,948 HelpFormatter - -------------------------------------------------------------------------------- 
INFO  16:07:22,948 HelpFormatter - -------------------------------------------------------------------------------- 
INFO  16:07:23,280 GenomeAnalysisEngine - Strictness is SILENT 
INFO  16:07:23,403 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 1000 
INFO  16:07:23,574 MicroScheduler - Running the GATK in parallel mode with 36 total threads, 1 CPU thread(s) for each of 36 data thread(s), of 48 processors available on this machine 
INFO  16:07:23,701 GenomeAnalysisEngine - Preparing for traversal 
INFO  16:07:23,705 GenomeAnalysisEngine - Done preparing for traversal 
INFO  16:07:23,706 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING] 
INFO  16:07:23,706 ProgressMeter -                 | processed |    time |    per 1M |           |   total | remaining 
INFO  16:07:23,706 ProgressMeter -        Location |     sites | elapsed |     sites | completed | runtime |   runtime 
INFO  16:07:53,723 ProgressMeter - NC_000067.6:144540201      1.28E8    30.0 s       0.0 s        5.3%     9.4 m       8.9 m 
INFO  16:08:23,806 ProgressMeter - NC_000068.7:11335701      1.94E8    60.0 s       0.0 s        7.6%    13.2 m      12.2 m 
INFO  16:08:53,841 ProgressMeter - NC_000068.7:78999901   2.62471971E8    90.0 s       0.0 s       10.1%    14.9 m      13.4 m 
INFO  16:09:23,964 ProgressMeter - NC_000068.7:136999901   3.25471971E8   120.0 s       0.0 s       12.2%    16.4 m      14.4 m 
INFO  16:09:54,102 ProgressMeter - NC_000069.6:16999901   3.88585195E8     2.5 m       0.0 s       14.5%    17.3 m      14.8 m 
INFO  16:10:24,427 ProgressMeter - NC_000069.6:81057901   4.46585195E8     3.0 m       0.0 s       16.8%    17.8 m      14.8 m 
INFO  16:10:54,599 ProgressMeter - NC_000069.6:148214401   5.04585195E8     3.5 m       0.0 s       19.3%    18.1 m      14.6 m 
INFO  16:11:24,921 ProgressMeter - NC_000070.6:38804101   5.69624875E8     4.0 m       0.0 s       21.1%    19.0 m      15.0 m 
INFO  16:11:55,015 ProgressMeter - NC_000070.6:105999901   6.29624875E8     4.5 m       0.0 s       23.6%    19.1 m      14.6 m 
INFO  16:12:25,096 ProgressMeter - NC_000071.6:7734201   6.89624875E8     5.0 m       0.0 s       25.8%    19.5 m      14.5 m 
INFO  16:12:55,351 ProgressMeter - NC_000071.6:68405801   7.52132991E8     5.5 m       0.0 s       28.0%    19.7 m      14.2 m 
INFO  16:13:25,454 ProgressMeter - NC_000071.6:140296601   8.12132991E8     6.0 m       0.0 s       30.6%    19.7 m      13.6 m 
INFO  16:13:55,785 ProgressMeter - NC_000072.6:41999901   8.81967675E8     6.5 m       0.0 s       32.6%    20.1 m      13.5 m 
INFO  16:14:25,985 ProgressMeter - NC_000072.6:94999901   9.29967675E8     7.0 m       0.0 s       34.5%    20.4 m      13.3 m 
INFO  16:14:56,287 ProgressMeter - NC_000073.6:7225501   9.88967675E8     7.5 m       0.0 s       36.8%    20.5 m      12.9 m 
INFO  16:15:26,297 ProgressMeter - NC_000073.6:51999901   1.044704221E9     8.0 m       0.0 s       38.4%    20.9 m      12.9 m 
INFO  16:15:56,453 ProgressMeter - NC_000073.6:128014401   1.097704221E9     8.5 m       0.0 s       41.2%    20.7 m      12.2 m 
INFO  16:16:26,581 ProgressMeter - NC_000074.6:32999901   1.17014568E9     9.0 m       0.0 s       43.1%    21.0 m      11.9 m 
INFO  16:16:56,874 ProgressMeter - NC_000074.6:97999901   1.22914568E9     9.6 m       0.0 s       45.5%    21.0 m      11.5 m 
INFO  16:17:27,138 ProgressMeter - NC_000075.6:33693401   1.289546893E9    10.1 m       0.0 s       47.9%    21.0 m      11.0 m 
INFO  16:17:57,593 ProgressMeter - NC_000075.6:83999901   1.348546893E9    10.6 m       0.0 s       49.7%    21.2 m      10.7 m 
INFO  16:18:27,651 ProgressMeter - NC_000076.6:32999901   1.416142003E9    11.1 m       0.0 s       52.4%    21.1 m      10.0 m 
INFO  16:18:57,828 ProgressMeter - NC_000076.6:92999901   1.474142003E9    11.6 m       0.0 s       54.6%    21.2 m       9.6 m 
INFO  16:19:27,910 ProgressMeter - NC_000077.6:20049601   1.532836996E9    12.1 m       0.0 s       56.7%    21.3 m       9.2 m 
INFO  16:19:58,237 ProgressMeter - NC_000077.6:78999901   1.602836996E9    12.6 m       0.0 s       58.9%    21.3 m       8.8 m 
INFO  16:20:28,247 ProgressMeter - NC_000078.6:25999901   1.665919539E9    13.1 m       0.0 s       61.4%    21.3 m       8.2 m 
INFO  16:20:58,267 ProgressMeter - NC_000078.6:90999901   1.732919539E9    13.6 m       0.0 s       63.8%    21.3 m       7.7 m 
INFO  16:21:28,376 ProgressMeter - NC_000079.6:38925901   1.794048561E9    14.1 m       0.0 s       66.3%    21.2 m       7.2 m 
INFO  16:21:58,544 ProgressMeter - NC_000079.6:97482301   1.851048561E9    14.6 m       0.0 s       68.4%    21.3 m       6.7 m 
INFO  16:22:28,722 ProgressMeter - NC_000080.6:45083501   1.9224702E9    15.1 m       0.0 s       70.9%    21.3 m       6.2 m 
INFO  16:22:58,892 ProgressMeter - NC_000080.6:117999901   1.9884702E9    15.6 m       0.0 s       73.6%    21.2 m       5.6 m 
INFO  16:23:28,971 ProgressMeter - NC_000081.6:58225001   2.052372444E9    16.1 m       0.0 s       76.0%    21.2 m       5.1 m 
INFO  16:23:59,036 ProgressMeter - NC_000082.6:15999901   2.110372444E9    16.6 m       0.0 s       78.3%    21.2 m       4.6 m 
INFO  16:24:29,111 ProgressMeter - NC_000082.6:85802101   2.178416129E9    17.1 m       0.0 s       80.8%    21.1 m       4.0 m 
INFO  16:24:59,175 ProgressMeter - NC_000083.6:33999901   2.238623897E9    17.6 m       0.0 s       82.5%    21.3 m       3.7 m 
INFO  16:25:29,331 ProgressMeter - NC_000083.6:84758401   2.290623897E9    18.1 m       0.0 s       84.4%    21.4 m       3.3 m 
INFO  16:25:59,601 ProgressMeter - NC_000084.6:42999901   2.351611168E9    18.6 m       0.0 s       86.4%    21.5 m       2.9 m 
INFO  16:26:29,851 ProgressMeter - NC_000085.6:26999901   2.420313807E9    19.1 m       0.0 s       89.1%    21.4 m       2.3 m 
INFO  16:27:00,149 ProgressMeter - NC_000086.7:55531001   2.506745373E9    19.6 m       0.0 s       92.4%    21.2 m      96.0 s 
INFO  16:27:30,234 ProgressMeter - NC_000086.7:140398101   2.590745373E9    20.1 m       0.0 s       95.5%    21.0 m      56.0 s 
INFO  16:27:49,193 ProgressMeter -            done   2.725537669E9    20.4 m       0.0 s      100.0%    20.4 m       0.0 s 
INFO  16:27:49,193 ProgressMeter - Total runtime 1225.49 secs, 20.42 min, 0.34 hours 
INFO  16:28:12,666 GATKRunReport - Uploaded run statistics report to AWS S3 

I don't understand though command run successfully why out.interval is empty.

Please help

Thanks you
Chirag

Best Answer

Answers

  • chiragchirag University of MacauMember
    edited July 2015

    @Sheila

    Hi Sheila,

    Thanks for the reply. I did that and it worked.

    Cheers
    Chirag.

  • mkfpmkfp Member
    edited October 2015

    I have a similar problem, but I am using my bam file :) and I am receiving an empty target intervals list.

    Unfortunately, I am using bam files from somebody else. Could a different set of SQ SN in the bam header and hg19.fasta be to blame? I am using fasta from gatk bundle. All chromosomes present in the bam header are also present in the fasta file but not vice versa.

    I already changed the names to the ones in the fasta file:

    Here are the fragments of the header and the reads from the bam file.

    Please let me know whether more info is needed. Thanks in advance!!!

    SOMETHING-87-f 0 HG19-chr07 31010713 40 78M * 0 0 TTCTGTCTCTGCCCTTCCCAGGAATCTTACTTCTCCACAGTGAAGATTATCTACACCGTGGGCCATAGCATCTCTATT aaaaaeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee NM:i:0
    SOMETHING-98-f 16 HG19-chr21 42769546 40 126M * 0 0 CCTGGAGGAGGGGTCAGCCACGGTTCCCCGACTGGCAGAAAGACTTACCACTGAACTCATCATGCATATCCAAGTGAGCCACGTGGGTTGGGTGACAAGTCATCAATACAGCATGCCCAAGTCACT VeeeeeeeNeNaaeeeeeeaeeeeaeeaeeeeeeeeeeeeeeeeeeeeeeeeeaaeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeae[eeeNeeeeeeeeeeeeeeeeeeeeeaaaaa NM:i:0
    SOMETHING-143-r 16 HG19-chr11 118969261 40 15M * 0 0 ATTTTTGTCTAAGTT eeeeeeeeeeaaaaa NM:i:0
    SOMETHING-157-f 0 HG19-chr02 9599585 40 68M * 0 0 GTGGGTTGTAGTTGTAGCCTTTGTGGTTGGTCACCCTAGGTAGGTCACTTCCTAAGTCTGCCTTTTGC [a[N[eeaaa[[[N[eNN[[N[eeae[[N[[NaNN[NNNN[eNeaeeee[[N[[eN[[N[eNN[aeee NM:i:1

    [m]$ samtools view -H 1001.tumor.bam
    @HD N:1.0 SO:unsorted
    @SQ SN:HG19-chr01 LN:249250621
    @SQ SN:HG19-chr02 LN:243199373
    @SQ SN:HG19-chr03 LN:198022430
    @SQ SN:HG19-chr04 LN:191154276
    @SQ SN:HG19-chr05 LN:180915260

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    @mkfp What weird fasta file are you using? I've never seen that form of the contig names.

    Remember that if you mess around with contig names, you'll need to regenerate all index and dictionary files. Also, make sure your files are sorted according to input requirements stated in the FAQs.

Sign In or Register to comment.