Heads up:
We’re moving the GATK website, docs and forum to a new platform. Read the full story and breakdown of key changes on this blog.
We’re moving the GATK website, docs and forum to a new platform. Read the full story and breakdown of key changes on this blog.
Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!
Test-drive the GATK tools and Best Practices pipelines on Terra
Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.
(howto) Perform local realignment around indels

NOTE: This tutorial has been replaced by a more recent and much improved version that you can find here.
Objective
Perform local realignment around indels to correct mapping-related artifacts.
Prerequisites
- TBD
Steps
- Create a target list of intervals to be realigned
- Perform realignment of the target intervals
1. Create a target list of intervals to be realigned
Action
Run the following GATK command:
java -jar GenomeAnalysisTK.jar \ -T RealignerTargetCreator \ -R reference.fa \ -I dedup_reads.bam \ -L 20 \ -known gold_indels.vcf \ -o realignment_targets.list
Expected Result
This creates a file called realignment_targets.list
containing the list of intervals that the program identified as needing realignment within our target, chromosome 20.
The list of known indel sites (gold_indels.vcf
) are used as targets for realignment. Only use it if there is such a list for your organism.
2. Perform realignment of the target intervals
Action
Run the following GATK command:
java -jar GenomeAnalysisTK.jar \ -T IndelRealigner \ -R reference.fa \ -I dedup_reads.bam \ -targetIntervals realignment_targets.list \ -known gold_indels.vcf \ -o realigned_reads.bam
Expected Result
This creates a file called realigned_reads.bam
containing all the original reads, but with better local alignments in the regions that were realigned.
Note that here, we didn’t include the -L 20
argument. It's not necessary since the program will only run on the target intervals we are providing.
Post edited by Geraldine_VdAuwera on
Tagged:
This discussion has been closed.
Comments
Which "known" file should I use??
ftp://[email protected]/bundle/2.5/hg19/Mills_and_1000G_gold_standard.indels.hg19.vcf.gz
or
ftp://[email protected]/bundle/2.5/hg19/1000G_phase1.indels.hg19.vcf.gz
Please have a look at the FAQ article on recommended known sets to use per tool.
I'd like to analyze our data from malignant cells containing 4bp somatic indel but it is not aligned properly by BWA so I tried to realign it by indel realignment procedure according to the Best Practices and this howto but I was not succesfull. I tried to change final vcf file to contain proper indel instead of wrong one but indel was not realigned with this file used as input VCF file with known indels in both steps of indel realignment. The sequences are:
Consensus:
CAAGATCTCTGGCAGTGGAGG
Alignment according to bwa mem (indel is bold):
CAAGATCTCTGCCTGGCAGTGGAGG
Real indel (indel is bold):
CAAGATCTCTGCCTGGCAGTGGAGG
Could you help me ,please, how to set indel realignment to work as I`d like it to?
Thank you.
@Vewehr -
I'm confused by this - the two sequences you posted are exactly the same, only the position of the reported indel in them differs. But in terms of identifying the correct indel, you're already there.
The GATK's convention is to left-align indels - that is, report the smallest coordinate that correctly represents the variation. I don't believe that can be changed. Ultimately, you just need to make sure that all of your indels are treated the same way (always use the smallest or the largest correct coordinate). The simplest way to do that is to run your comparison VCFs through LeftAlignAndTrimVariants
Thanks a lot. I was not aware of left-align convention. The problem is, that there are several different variants present and they are all misaligned. I thought I would be able to realign them properly but I will probably have to make some conversion table :-).
For realignment of amplicon reads with a very small target ROI (~3kb) can I omit the RealignerTargetCreator step and submit the entire ROI to the IndelRealigner? Would there be any negative consequence of doing this (apart from performance)?
Many thanks
Matt
@mlyon - If memory serves, IndelRealigner will only attempt a single realignment per target. So if your amplicon contains multiple indels, it would only clean up one of them
Hi @mylon
@pdexheimer is correct, so you're better off running the RTC step. On such a small area it will take a very short time so I can't really se the point of skipping it.
Thanks for the great tool.
The last sentence in the tutorial can be a bit confusing: "Note that here, we didn’t include the -L 20 argument. It's not necessary ...". If you add -L 20, it will limit the output to chr 20 only (other reads will be filtered out in the output bam) so the output will not be the same.
@mghandi
Hi,
The last sentence is meant to point out that even if you used the -L argument in Realigner Target Creator, you do not need to use it when running Indel Realigner. This is because Indel Realigner only realigns around the intervals given in the output file of Realigner Target Creator. So, if you have already put in the intervals you want to focus on in Realigner Target Creator, you do not need to input them again into Indel Realigner.
I hope this clarifies things.
-Sheila
Hello,
In the 2.8 bundle (hg19), there are two dbsnp vcf files (dbsnp_138 and dbsnp_130.excluding_sites_after_129). Which of these is recommended to be used with the base recalibrator (knownsites)?
Thanks,
@simonsanchezj
Hi,
The dbsnp_138 file is the basic recommendation for our users. The other file, dbsnp_130.excluding_sites_after_129, is a specially modified callset containing the set of sites from dbsnp 129, but updated with annotations from 130. It's meant to be used to replicate some findings from the original GATK paper, so it is more for internal Broad purposes.
-Sheila
thanks!
I'm thinking about performing local realignment around indels with one of my own datasets. It turns out that I have a VCF for structural variants that includes insertions and deletions (but also other things like copy number variation, gene duplication and tandem duplication). I'm just wondering if simply removing all of the lines for types of structural variant other than insertions and deletions is going to be a safe way of creating a VCF with known indels only? Also, I'm assuming that it is undesirable to do re-alignment around the other types of structural variant; but perhaps that is wrong (as I guess some of these structural variants have various things in common with indels and possibly some of the same issues)? Indeed having a look at the notes in the presentation it seems likely that it would be desirable to do re-alignment around all of the structural variants I mentioned; but it's not clear what are the best options to use with the IndelRealigner (e.g. should I use the full Smith-Waterman realignment)? (By the way, I have two examples of structural variants that are described in my VCF file as "complex structural alterations" - I'm not sure what those are or if they are even remotely like indels?)
William
@WVNicholson
Hi William,
You should be able to simply input your file as it is, but if you want, you can use Select Variants to select the indels only. https://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_gatk_tools_walkers_variantutils_SelectVariants.php
-Sheila
Hi,
I was wondering what the differences are between IndelRealigner vs. LeftAlignAndTrimVariants.
Is running one of the two sufficient for accurate indel calling?
I have my own understanding of the two modules but want to be clarified by GATK team officially.
Thanks in advance!
Hi @hoosier060,
Those are two completely different tools -- IndelRealigner cleans up indels in BAM files (important for calling) and LAATV normalizes indel representations in VCF files (typically used for files generated with a different program or after subsetting).
@Carneiro @Geraldine_VdAuwera (I've posted this question elsewhere, but I think this is a better place to ask) For updates, I'm using GATK-3.3.0 and want to be clear with the default option for -mode.
is USE_READS the default behavior if not specified? Please update your tool documentation with the default value, which is stated as "NA". Thanks.
@SerenaRhie In future please don't post the same question in two different places, it makes the job of maintaining the forum more difficult.
Yes,
USE_READS
is the default value. I'm not sure why the defaults are not getting written properly in the doc; will check & fix.@Geraldine_VdAuwera Thank you for your reply! ...And sorry for the inconvenience.
Hello,
While creating a target list of intervals to be realigned from my BAM file I am getting the following error message:
ERROR MESSAGE: SAM/BAM/CRAM file [email protected]b085bce is malformed: BAM file has a read with mismatching number of bases and base qualities. Offender: HISEQ:429:C68GLACXX:1:1214:18721:100660 [126 bases] [0 quals]. You can use --defaultBaseQualities to assign a default base quality for all reads, but this can be dangerous in you don't know what you are doing.
What should I do to check the error in the BAM file? I have used BWA Mem for realignment and Picardtools for marking duplicates. This is an exome sample.
Please help.
More information regarding this error. I have checked the BAM file in Picardtools using ValidateSamFile function and no errors were reported by the program. Any reply to my queries or how can I solve this problem!!
@aneek
Hi,
This thread will help you: http://gatkforums.broadinstitute.org/discussion/1429/error-bam-file-has-a-read-with-mismatching-number-of-bases-and-base-qualities
-Sheila
@Sheila
Thank you very much for this very useful information. Problem is solved.
Hi,
I am trying to do local realignment around Indels on Exome Seq data from human. I have performed all the previous steps as mentioned in the best practices. The reference used for mapping using BWA was from "ftp://ftp.ncbi.nih.gov/genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh38/seqs_for_alignment_pipelines/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bwa_index.tar.gz"
This reference is in .fna format and associated .fai file is also present.
Can you please guide me on how I can convert (or) use this file as -R for performing local realignment around the Indels?
I tried the pipelines for preparing reference genome given in
http://gatkforums.broadinstitute.org/discussion/1601/how-can-i-prepare-a-fasta-file-to-use-as-reference?
and
https://www.broadinstitute.org/gatk/guide/article?id=2798
But the faidx command in samtools does not seem to recognize the reference fna file I use.
Please help.
@arunkumar.gp
Hi,
What happens if you simply change the .fna suffix to a .fa suffix?
-Sheila
@arunkumar.gp If samtools is giving you an error, then you should ask for help on the samtools mailing list. We are not responsible for providing support for samtools, and we are not the best source of information on what that software does or does not support.