Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

No gender data for sample

wheatwillwheatwill China,Wuhan,Huazhong agriculture university Member

Hi!
I am trying to run the SVToolkit.2.00.1533 on rice ,which is a self-pollinated pants and has no genders.I got an error for" No gender data for sample".

Because my samples ,rice, a self-pollinated pants and has no genders. I edit the related files like this.

input_bam_files_gender.map:

LGW1.reheader 1
LGW2.reheader 1
LGW3.reheader 1

............

rice7_reference.ploidymap.txt:

* * * * 2

rice7_reference_rdmask.bed:

chr01 1 43270923
chr02 1 35937250
chr03 1 36413819
chr04 1 35502694
chr05 1 29958434
chr06 1 31248787
chr07 1 29697621
chr08 1 28443022
chr09 1 23012720
chr10 1 23207287
chr11 1 29021106

chr12 1 27531856

There is a part of my log files.

INFO 22:22:30,326 SVDiscovery - Initializing SVDiscovery ...
INFO 22:22:30,327 SVDiscovery - Reading configuration file ...
INFO 22:22:30,336 SVDiscovery - Read configuration file.
INFO 22:22:30,336 SVDiscovery - Opening reference sequence ...
INFO 22:22:30,338 SVDiscovery - Opened reference sequence.
INFO 22:22:30,339 SVDiscovery - Opening genome mask ...
INFO 22:22:30,341 SVDiscovery - Opened genome mask.
INFO 22:22:30,341 SVDiscovery - Initializing input data set ...
INFO 22:22:30,393 SVDiscovery - Initialized data set: 3 files, 66 read groups, 3 samples.
INFO 22:22:30,395 MetaData - Opening metadata ...
INFO 22:22:30,396 MetaData - Adding metadata directory rice_discovery/metadata ...
INFO 22:22:30,398 MetaData - Opened metadata.
INFO 22:22:30,402 SVDiscovery - Opened metadata.
INFO 22:22:30,415 MetaData - Loading insert size distributions ...
INFO 22:22:30,447 SVDiscovery - Discovery alt home filtering is disabled.
INFO 22:22:30,503 SVDiscovery - Processing locus: chr01:0-0:100-1000000
INFO 22:22:30,504 SVDiscovery - Locus search window: chr01:0-0
INFO 22:23:00,334 ProgressMeter - Starting 0.0 30.0 s 49.6 w 100.0% 30.0 s 0.0 s
INFO 22:23:30,336 ProgressMeter - Starting 0.0 60.0 s 99.2 w 100.0% 60.0 s 0.0 s
INFO 22:24:00,338 ProgressMeter - Starting 0.0 90.0 s 148.8 w 100.0% 90.0 s 0.0 s
INFO 22:24:30,340 ProgressMeter - Starting 0.0 120.0 s 198.4 w 100.0% 120.0 s 0.0 s
INFO 22:25:00,341 ProgressMeter - Starting 0.0 2.5 m 248.0 w 100.0% 2.5 m 0.0 s
INFO 22:25:30,343 ProgressMeter - Starting 0.0 3.0 m 297.6 w 100.0% 3.0 m 0.0 s
INFO 22:26:00,344 ProgressMeter - Starting 0.0 3.5 m 347.3 w 100.0% 3.5 m 0.0 s
INFO 22:26:30,346 ProgressMeter - Starting 0.0 4.0 m 396.9 w 100.0% 4.0 m 0.0 s
INFO 22:27:00,354 ProgressMeter - Starting 0.0 4.5 m 446.5 w 100.0% 4.5 m 0.0 s
INFO 22:27:30,356 ProgressMeter - Starting 0.0 5.0 m 496.1 w 100.0% 5.0 m 0.0 s
INFO 22:28:00,372 ProgressMeter - Starting 0.0 5.5 m 545.7 w 100.0% 5.5 m 0.0 s

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

java.lang.RuntimeException: No gender data for sample: LGW1
at org.broadinstitute.sv.discovery.ClusterMembershipModule.init(ClusterMembershipModule.java:180)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.createMembershipModule(DeletionDiscoveryAlgorithm.java:
1047)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.initClusterModules(DeletionDiscoveryAlgorithm.java:992)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processClusters(DeletionDiscoveryAlgorithm.java:325)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:192)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:109)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:42)
at org.broadinstitute.gatk.engine.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at org.broadinstitute.gatk.engine.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:116)
at org.broadinstitute.gatk.engine.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:319)
at org.broadinstitute.gatk.engine.CommandLineExecutable.execute(CommandLineExecutable.java:121)
at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:125)
at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:248)
at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:155)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:79)
at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version ):
ERROR
ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
ERROR If not, please post the error message, with stack trace, to the GATK forum.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: No gender data for sample: LGW1
ERROR ------------------------------------------------------------------------------------------

INFO 22:28:39,463 QGraph - Writing incremental jobs reports...
INFO 22:28:39,464 QGraph - 1 Pend, 0 Run, 1 Fail, 0 Done
INFO 22:28:39,467 QCommandLine - Writing final jobs report...
INFO 22:28:39,468 QCommandLine - Done with errors
INFO 22:28:39,471 QGraph - -------
INFO 22:28:39,474 QGraph - Failed: 'java' '-Xmx4096m' '-XX:+UseParallelOldGC' '-XX:ParallelGCThreads=4' '-XX:GCTimeLimit=50' '-XX:GCHeapFreeLimit=10' '-Djava.io.tmpdir=/home/ligw/tools/svtoolkit2.1553/svtoolkit/worktest/tmpdir.rice' '-cp' '/home/ligw/tools/svtoolkit2.1553/svtoolkit/lib/SVToolkit.jar:/home/ligw/tools/svtoolkit2.1553/svtoolkit/lib/gatk/GenomeAnalysisTK.jar:/home/ligw/tools/svtoolkit2.1553/svtoolkit/lib/gatk/Queue.jar' org.broadinstitute.sv.main.SVDiscovery '-T' 'SVDiscoveryWalker' '-R' '/home/ligw/tools/svtoolkit2.1553/svtoolkit/worktest/data/rice7_reference.fasta' '-I' 'data/input_bam_files.list' '-O' '/home/ligw/tools/svtoolkit2.1553/svtoolkit/worktest/rice_discovery/rice1.discovery.unfiltered.vcf' '-disableGATKTraversal' 'true' '-md' 'rice_discovery/metadata' '-configFile' 'conf/genstrip_installtest_parameters.txt' '-P' 'select.validateReadPairs:false' '-runDirectory' 'rice_discovery' '-genderMapFile' 'data/input_bam_files_gender.map' '-genomeMaskFile' 'data/rice7_reference_svmask.fasta' '-L' 'chr01' '-runFilePrefix' 'rice1' '-searchLocus' 'chr01' '-searchWindow' 'chr01' '-searchMinimumSize' '100' '-searchMaximumSize' '1000000'
INFO 22:28:39,475 QGraph - Log: /home/ligw/tools/svtoolkit2.1553/svtoolkit/worktest/rice_discovery/logs/SVDiscovery-1.out

INFO 22:28:39,476 QCommandLine - Script failed: 1 Pend, 0 Run, 1 Fail, 0 Done

My script is based on installtest/discovery.sh as below

java -cp ${classpath} ${mx} \
org.broadinstitute.gatk.queue.QCommandLine \
-S ${SV_DIR}/qscript/SVPreprocess.q \
-S ${SV_DIR}/qscript/SVQScript.q \
-gatk ${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar \
--disableJobReport \
-cp ${classpath} \
-configFile conf/genstrip_installtest_parameters.txt \
-tempDir ${SV_TMPDIR} \
-R data/rice7_reference.fasta \
-genomeMaskFile data/rice7_reference_svmask.fasta \
-readDepthMaskFile data/rice7_reference_rdmask.bed \
-genderMapFile data/input_bam_files_gender.map \
-runDirectory ${runDir} \
-md ${runDir}/metadata \
-disableGATKTraversal \
-useMultiStep \
-L chr01 \
-reduceInsertSizeDistributions true \
-computeReadCounts true \
-computeGCProfiles true \
-jobLogDir ${runDir}/logs \
-I ${bam} \
-run \
|| exit 1

Run discovery.

java -cp ${classpath} ${mx} \
org.broadinstitute.gatk.queue.QCommandLine \
-S ${SV_DIR}/qscript/SVDiscovery.q \
-S ${SV_DIR}/qscript/SVQScript.q \
-gatk ${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar \
--disableJobReport \
-cp ${classpath} \
-configFile conf/genstrip_installtest_parameters.txt \
-tempDir ${SV_TMPDIR} \
-R data/rice7_reference.fasta \
-genomeMaskFile data/rice7_reference_svmask.fasta \
-genderMapFile data/input_bam_files_gender.map \
-runDirectory ${runDir} \
-P select.validateReadPairs:false \
-md ${runDir}/metadata \
-disableGATKTraversal \
-L chr01 \
-jobLogDir ${runDir}/logs \
-minimumSize 100 \
-maximumSize 1000000 \
-suppressVCFCommandLines \
-I ${bam} \
-O ${sites} \
-run \
|| exit 1

(grep -v ^##fileDate= ${sites} | grep -v ^##source= | grep -v ^##reference= | diff -q - benchmark/${sites}) \
|| { echo "Error: test results do not match benchmark data"; exit 1; }

Run genotyping on the discovered sites.

java -cp ${classpath} ${mx} \
org.broadinstitute.gatk.queue.QCommandLine \
-S ${SV_DIR}/qscript/SVGenotyper.q \
-S ${SV_DIR}/qscript/SVQScript.q \
-gatk ${SV_DIR}/lib/gatk/GenomeAnalysisTK.jar \
--disableJobReport \
-cp ${classpath} \
-configFile conf/genstrip_installtest_parameters.txt \
-tempDir ${SV_TMPDIR} \
-R data/rice7_reference.fasta \
-genomeMaskFile data/rice7_reference_svmask.fasta \
-genderMapFile data/input_bam_files_gender.map \
-runDirectory ${runDir} \
-md ${runDir}/metadata \
-disableGATKTraversal \
-jobLogDir ${runDir}/logs \
-I ${bam} \
-vcf ${sites} \
-O ${genotypes} \
-run \
|| exit 1

How can I do with the no gender organism? Many thanks!

Best Answers

Answers

  • wheatwillwheatwill China,Wuhan,Huazhong agriculture university Member

    Thanks,bhandsaker!
    You are wright.The sample identifier is in the @RG tag of the bam header not the files' name. I mad a mistake. Although every single bam file contains a single sample in my file, they are not same named.

    If I supply no gender file, then script failed with no error report.I add the logs to attachment.
    By the way,if I supply no ploidymap file,it is complaining about a missing ploidy map"Argument with name '--ploidyMapFile' (-ploidyMapFile) is missing."
    If if I supply no rdmask.bed file,it is complaining about "The 1th sequences in the reference /home/ligw/tools/svtoolkit2.1553/svtoolkit/worktest/data is named chr13"

    Anyway,Genome_STRiP seems work now. Thank you ever so much!

  • bhandsakerbhandsaker Member, Broadie, Moderator admin

    Thanks for the feedback and for posting the log file.
    I would be curious to know if metadata/spans.dat looks to be intact (and whether there is a metadata/.spans.dat.done file, although I would presume there is not).
    I am curious whether queue somehow saw a non-zero exit status from java (perhaps transiently) or whether MergeReadSpanCoverage actually did fail but the code failed to report the error.

  • wheatwillwheatwill China,Wuhan,Huazhong agriculture university Member
    edited February 2015

    Yes, there isn't a metadata/.spans.dat.done file. Actually,there is a metadata/.spans.dat.fail.
    But the spans.dat contains all samples and RG of my samples:
    [[email protected] metadata]$ cat spans.dat
    SAMPLE LIBRARY READGROUP SPANCOVERAGE
    LGW1 LGW1 006171LGW1_CGATGT_L008_001 13689580
    LGW1 LGW1 006171LGW1_CGATGT_L008_002 13240925
    LGW1 LGW1 006171LGW1_CGATGT_L008_003 12733933
    LGW1 LGW1 006171LGW1_CGATGT_L008_004 12657268
    LGW1 LGW1 006171LGW1_CGATGT_L008_005 13739707
    LGW1 LGW1 006171LGW1_CGATGT_L008_006 13158855
    LGW1 LGW1 006171LGW1_CGATGT_L008_007 12681098
    ............

    All the files in the metadata are listed fellow
    [[email protected] metadata]$ ls -a
    . gcprofiles.zip .isd.dist.bin.done .mdversion.txt.done .rccache.bin.idx.done .spans.dat.fail
    .. .gcprofiles.zip.done isd.hist.bin profiles_100Kb rccache.list
    depth genome_sizes.txt .isd.hist.bin.done rccache .rccache.list.done
    depth.dat .genome_sizes.txt.done isd.stats.dat rccache.bin rccache.merge
    .depth.dat.done isd .isd.stats.dat.done .rccache.bin.done spans
    gcprofile isd.dist.bin mdversion.txt rccache.bin.idx spans.dat

  • bhandsakerbhandsaker Member, Broadie, Moderator admin

    Thanks, this is good to know.
    I think the problem is something related to java (or some wrapper around it generated by queue) getting an error, even though the MergeReadSpanCoverage job succeeded. So it is likely a transient error and if you rerun preprocessing it will likely successfully recreate the spans.dat file, clear the failed status, and keep going.

  • wheatwillwheatwill China,Wuhan,Huazhong agriculture university Member

    Yes, I think you presumption is all wright. When I keep going run my population with 21 samples each over 50X coverage paired-end sequencing on the Illumina platform.
    I got an error on "org.broadinstitute.sv.apps.MergeReadDepthCoverage"
    So I run again separating each chromosome thought parameter "-L ", but I meet an error on "org.broadinstitute.sv.apps.MergeReadSpanCoverage".
    I just rerun my scrip again. Amazing, the preprocessing successfully recreate,SVPreprocess complete.
    Do you know there is any solutions that I can avoid this little trouble ?
    Thanks for you patience and so many help! I post all related the log file on attachment for detail.

  • bhandsakerbhandsaker Member, Broadie, Moderator admin
    edited February 2015

    As to the problem about the transient failures, it is hard to tell. It is likely some interaction between Queue and your job scheduler and your environment (e.g. file systems). It might have to do with writing the .done file or with the job report file (you could try --disableJobReport).

    The second problem in your log files is more important. The deletion discovery pipeline doesn't like one of your read pairs.
    It looks like maybe we aren't handling the supplementary alignment flag right. Would it be possible for you to grep out all of the alignments for HWI-ST1395:98:c27wjacxx:7:2201:17052:11013 from the LGW6 bam file? The error message is reporting on two alignments, but one is supplementary so I suspect there are one or more other alignments for this read pair.

    The error message I'm talking about is this one:

    #DBG: HWI-ST1395:98:c27wjacxx:7:2201:17052:11013    2147    chr04   244009  45  30M70H  =   244075  159 CATTCAAATGTCACTACTACACAAAATCTA  @CCFFFFFHHDHHJJJJJJJJJJJJIJJJJ  SA:Z:chr04,244074,+,43S57M,45,4;    MD:Z:30 RG:Z:840071LGW6_GGCTAC_L007_017 NM:i:0  AS:i:30 XS:i:0
    #DBG: HWI-ST1395:98:c27wjacxx:7:2201:17052:11013    99  chr04   244074  45  43S57M  =   244075  94  CATTCAAATGTCACTACTACACAAAATCTACAAATGTGCCGTTTTTTCCAACCGGCATCATGGAGGCGACACTGATCAAAAGGCTCATCGGTGCCGAATT    @CCFFFFFHHDHHJJJJJJJJJJJJIJJJJJJJJJIGIIJIGGIIJJJIIIJJIJJJHHHHFFFFFDDDDDDDDDACDCDCDBBCBDDDDBBDDCDDBDD    SA:Z:chr04,244009,+,30M70S,45,0;    MD:Z:17C0A6G9G21    RG:Z:840071LGW6_GGCTAC_L007_017 NM:i:4  AS:i:37 XS:i:0
    #DBG: Error processing sample: LGW6
    #DBG: Error processing input file: /home/ligw/ijcross/seq_alin/bwamap/reheader_bam/LGW6.reheader.bam
    Error: Exception processing cnp: Right read of read pair fails right read test: HWI-ST1395:98:c27wjacxx:7:2201:17052:11013  99  chr04   244074  45  43S57M  =   244075  94  CATTCAAATGTCACTACTACACAAAATCTACAAATGTGCCGTTTTTTCCAACCGGCATCATGGAGGCGACACTGATCAAAAGGCTCATCGGTGCCGAATT    @CCFFFFFHHDHHJJJJJJJJJJJJIJJJJJJJJJIGIIJIGGIIJJJIIIJJIJJJHHHHFFFFFDDDDDDDDDACDCDCDBBCBDDDDBBDDCDDBDD    SA:Z:chr04,244009,+,30M70S,45,0;    MD:Z:17C0A6G9G21    RG:Z:840071LGW6_GGCTAC_L007_017 NM:i:4  AS:i:37 XS:i:0
    CNP: DEL_4 chr04:244166-245476
    ##### ERROR ------------------------------------------------------------------------------------------
    ##### ERROR stack trace 
    java.lang.IllegalArgumentException: Right read of read pair fails right read test: HWI-ST1395:98:c27wjacxx:7:2201:17052:11013   99  chr04   244074  45  43S57M  =   244075  94  CATTCAAATGTCACTACTACACAAAATCTACAAATGTGCCGTTTTTTCCAACCGGCATCATGGAGGCGACACTGATCAAAAGGCTCATCGGTGCCGAATT    @CCFFFFFHHDHHJJJJJJJJJJJJIJJJJJJJJJIGIIJIGGIIJJJIIIJJIJJJHHHHFFFFFDDDDDDDDDACDCDCDBBCBDDDDBBDDCDDBDD    SA:Z:chr04,244009,+,30M70S,45,0;    MD:Z:17C0A6G9G21    RG:Z:840071LGW6_GGCTAC_L007_017 NM:i:4  AS:i:37 XS:i:0
    
  • wheatwillwheatwill China,Wuhan,Huazhong agriculture university Member

    Hi! I'm sorry for late.
    After I filtered out this read pair, I found there were more than one of my read pairs that the deletion discovery pipeline complained. Whenever I run, I always encountered this trouble.
    Yes,there are there alignments for this read pair. According to posted discussions, I ran picard's FixMateInformation. However,it doesn’t seems worked.
    This is the alignments for HWI-ST1395:98:c27wjacxx:7:2201:17052:11013

    HWI-ST1395:98:c27wjacxx:7:2201:17052:11013 2147 chr04 244009 45 30M70H = 244075 159 CATTCAAATGTCACTACTACACAAAATCTA @CCFFFFFHHDHHJJJJJJJJJJJJIJJJJ NM:i:0 MD:Z:30 AS:i:30 XS:i:0 SA:Z:chr04,244074,+,43S57M,45,4; RG:Z:840071LGW6_GGCTAC_L007_017
    HWI-ST1395:98:c27wjacxx:7:2201:17052:11013 99 chr04 244074 45 43S57M = 244075 94 CATTCAAATGTCACTACTACACAAAATCTACAAATGTGCCGTTTTTTCCAACCGGCATCATGGAGGCGACACTGATCAAAAGGCTCATCGGTGCCGAATT @CCFFFFFHHDHHJJJJJJJJJJJJIJJJJJJJJJIGIIJIGGIIJJJIIIJJIJJJHHHHFFFFFDDDDDDDDDACDCDCDBBCBDDDDBBDDCDDBDD NM:i:4 MD:Z:17C0A6G9G21 AS:i:37 XS:i:0 SA:Z:chr04,244009,+,30M70S,45,0; RG:Z:840071LGW6_GGCTAC_L007_017
    HWI-ST1395:98:c27wjacxx:7:2201:17052:11013 147 chr04 244075 60 93M7S = 244074 -94 TTTCCAACCGGCATCATGGAGGCGACACTGATCAAAAGGCTCATCGGTGCCGAATTGAGAACCGGTACTGATTAGTTGCACGATTCCAAAAAATCGGTCG DDCBB<9BDDDCCCCDDBDDDDDDDCACEDDDDDDDDDDDDDDDDDDFFHHHHIJJJJJIHJJJJIGIIGGHEIJJJJIIJJJJJJJHHHHHFFFFFCCC NM:i:5 MD:Z:16C0A6G9G33C24 AS:i:68 XS:i:0 RG:Z:840071LGW6_GGCTAC_L007_017

    And this is after fixed by picard's FixMateInformation.

    HWI-ST1395:98:c27wjacxx:7:2201:17052:11013 2115 chr04 244009 45 30M70H = 244074 66 CATTCAAATGTCACTACTACACAAAATCTA @CCFFFFFHHDHHJJJJJJJJJJJJIJJJJ SA:Z:chr04,244074,+,43S57M,45,4; MD:Z:30 RG:Z:840071LGW6_GGCTAC_L007_017 NM:i:0 MQ:i:45 AS:i:30 XS:i:0
    HWI-ST1395:98:c27wjacxx:7:2201:17052:11013 67 chr04 244074 45 43S57M = 244009 -66 CATTCAAATGTCACTACTACACAAAATCTACAAATGTGCCGTTTTTTCCAACCGGCATCATGGAGGCGACACTGATCAAAAGGCTCATCGGTGCCGAATT @CCFFFFFHHDHHJJJJJJJJJJJJIJJJJJJJJJIGIIJIGGIIJJJIIIJJIJJJHHHHFFFFFDDDDDDDDDACDCDCDBBCBDDDDBBDDCDDBDD SA:Z:chr04,244009,+,30M70S,45,0; MD:Z:17C0A6G9G21 RG:Z:840071LGW6_GGCTAC_L007_017 NM:i:4 MQ:i:45 AS:i:37 XS:i:0
    HWI-ST1395:98:c27wjacxx:7:2201:17052:11013 147 chr04 244075 60 93M7S = 244074 -94 TTTCCAACCGGCATCATGGAGGCGACACTGATCAAAAGGCTCATCGGTGCCGAATTGAGAACCGGTACTGATTAGTTGCACGATTCCAAAAAATCGGTCG DDCBB<9BDDDCCCCDDBDDDDDDDCACEDDDDDDDDDDDDDDDDDDFFHHHHIJJJJJIHJJJJIGIIGGHEIJJJJIIJJJJJJJHHHHHFFFFFCCC NM:i:5 MD:Z:16C0A6G9G33C24 AS:i:68 XS:i:0 RG:Z:840071LGW6_GGCTAC_L007_017

    Thank you very much for the help!

  • wheatwillwheatwill China,Wuhan,Huazhong agriculture university Member

    Hi!Thanks very much for your response. I would be very appreciated if you could afford this fix for our urgent analysis, as Genome STRiP is such an excellent software in SV discovery and genotyping that it is expected indispensable。
    If it's convenient would you please send this by email [email protected] or [email protected]
    Thank you again for your help.

  • @bhandsaker said:
    And if you simply supply no gender file, then what happens?

    The error message is complaining about a sample named LGW1.
    In general, if you supply any gender information, you need to supply it for all samples.
    The sample identifier is in the @RG tag of the bam header.

    @bhandsaker said:
    And if you simply supply no gender file, then what happens?

    The error message is complaining about a sample named LGW1.
    In general, if you supply any gender information, you need to supply it for all samples.
    The sample identifier is in the @RG tag of the bam header.

    Hello, I'm not supplying any gender information and the same error arise. Must I supply it?

  • bhandsakerbhandsaker Member, Broadie, Moderator admin

    I would recommend starting a new post, rather than appending to this one from 2015.
    You also need to supply more context, like whether you are working with a custom reference bundle that you created yourself for a non-human genome, which release you are using, and the full stack trace of the error.

Sign In or Register to comment.