If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra

Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

haplotye Caller


I am using GATK version 3.3 (latest release) and following the best practice for variant calling. Steps i am using is
1. Run haplotye caller and get the gVCF file
2. Run GenotypeGVCF across the samples to the get the VCF file

The Question is about the Genotype calling.
Here is an example:

GVCF file looks like this for a particular position
chr1 14677 . G . . END=14677 GT:DP:GQ:MIN_DP:PL 0/0:9:0:9:0,0,203

VCF file looks like this after genotyping with multiple samples.
chr1 14677 . G A 76.56 PASS . . GT:AD:DP:GQ:PL 0/1:8,1:9:4:4,0,180

In GVCF file there was no support for the alternate allele, but VCF file shows that there are 1 read supporting the alternate call.

Thanks ! Saurabh


  • SheilaSheila Broad InstituteMember, Broadie admin


    Hi Saurabh,

    Can you please post IGV screenshots of the original bam file and the bamout file for that position?


  • sbahetisbaheti Member

    IGV snapshot shows there is a read with a alternate allele. I didn't ran the HC using bamout option.
    GVCF has no information about that read though

    I don't know how to upload the snapshot here on the forum ..

    Thanks ! Saurabh

  • tommycarstensentommycarstensen United KingdomMember ✭✭✭
    edited January 2015

    @sbaheti said:
    I don't know how to upload the snapshot here on the forum ..

    It says "Attach a file" with blue font just below the "Leave a Comment" window to the left.

  • sbahetisbaheti Member

    Here is the igv snapshot.

    @tommycarstensen‌ thanks

    Thanks ! Saurabh

  • SheilaSheila Broad InstituteMember, Broadie admin


    Hi Saurabh,

    Can you please run Haplotype Caller with the -bamout argument and post the results here. The bamout file will show what the region looks like after reassembly.

    Also, can you check the qualities of the bases at the position?


  • sbahetisbaheti Member

    I ran this command for the interval i am having issues with but the bam file from bamout option is empty

    java -jar gatk/3.3-0/GenomeAnalysisTK.jar -T HaplotypeCaller -R $ref -I .bam -L chr1:14670-14690 --bamOutput test.bamout --emitRefConfidence GVCF --variant_index_type LINEAR --variant_index_parameter 128000 -o test.g.vcf

    There is one more thing, genotyping multiple sample gives the variant call but genotyping single sample doesn't give the variant call.

    here is the samtools mpileup result for that location
    chr1 14677 N 10 gGAGGggGgg HJ<GIGIHIH

    and it looks all are high quality bases.

    Thanks ! Saurabh

  • SheilaSheila Broad InstituteMember, Broadie admin
    edited January 2015


    Hi Saurabh,

    Please re-run the same command with -L chr1:14377-14977. There needs to be more padding around the site so an active region can be called, if there is one. You can read more about active regions here:

    When a call does not show up in a single sample vcf, but shows up in the multi-sample vcf, it is because the other samples have added evidence for variation at the site.


  • sbahetisbaheti Member

    Here is the output using the interval suggested by you.

    samtools view test.bamout
    R0211812:404:C5LHUACXX:3:1115:10866:5431 83 chr1 14444 29 44M = 14266 -222 TGGAAGCCTCTTAAGAACACTGTGGCGCAGGCTGGGTGGAGCCG EGGCDGEIDFECDFGCCDBH>[email protected]=;I=EGHEGGCC=BFCCD LB:Z:/data2/bsi/reference/sequence/human/ncbi/37.1/indexed/allchr.nix MC:Z:93M8S BD:Z:QPONPQQQONNMNONOMOPQNMQOOOPQPPQQQMPNRQQRQONN MD:Z:77A23 PG:Z:novoalign.1.3 RG:Z:s_A13501 BI:Z:SQPPRRSRRRORPQPOQPSTQQSQQQQRRQSTSORQSRQSSQRR AM:i:70 NM:i:1 SM:i:70 MQ:i:29 PQ:i:90 UQ:i:34 AS:i:34
    R0211812:404:C5LHUACXX:3:2307:10844:6412 83 chr1 14641 55 36M = 14600 -142 ATGTCAGAGCAACGGACCAAGTCTGGGTCTGGGGGG 555555555555555555555555555555555555 LB:Z:/data2/bsi/reference/sequence/human/ncbi/37.1/indexed/allchr.nix MC:Z:101M BD:Z:QNQPSQRQQQPPOQRPQPNPQOQQMPQOQQMMMMMP MD:Z:15C85 PG:Z:novoalign.11.N RG:Z:s_A13501 BI:Z:TRTSTSRTSRPRORTSRRQSTSUTPSTSUTPPPPOR AM:i:70 NM:i:1 SM:i:70 MQ:i:55 PQ:i:60 UQ:i:30 AS:i:30
    R0211812:404:C5LHUACXX:3:1214:14093:21267 99 chr1 14652 20 25M = 14851 300 ACGGCCCAAGTCTGGGTCTGGGGGG [email protected] LB:Z:/data2/bsi/reference/sequence/human/ncbi/37.1/indexed/allchr.nix MC:Z:101M BD:Z:NNOOSQNRNOPQOQQMPQOQPMMMM MD:Z:47C53 PG:Z:novoalign.3.7 RG:Z:s_A13501 BI:Z:RRSQSRPSRRSSQRQPRSQRQPPPP AM:i:70 NM:i:1 SM:i:70 MQ:i:20 PQ:i:40 UQ:i:40 AS:i:40
    R0211812:404:C5LHUACXX:3:2101:7330:33771 163 chr1 14887 70 64M = 14908 156 CCGGAGACTTAAATACAGGAGGAAAAAGGCAGGACAGAATTACGAGGTGCTGGCCCAGGGCGGG DDCEDHDFHCDDEEDFFGI555555555555555555155555555555555555555555555 LB:Z:/data2/bsi/reference/sequence/human/ncbi/37.1/indexed/allchr.nix HC:i:51474884 MC:Z:2S99M BD:Z:MMNOPQOQONMNFOLONQQPQQPOFFFOQQPQQPQNQOOOOMOOQQRQPQQRRRQNRRROSOOM MD:Z:56A22A21 PG:Z:novoalign.6.D RG:Z:s_A13501 BI:Z:PPOQTSSTSQRPKSRSRUSTSSTSKKKSSSSUSTTRUSSSQRSSSTSSQRSTSTSPUVSQTRQQ AM:i:70 NM:i:2 SM:i:70 MQ:i:70 PQ:i:120 UQ:i:60 AS:i:60
    R0211812:404:C5LHUACXX:3:2107:1842:92595 99 chr1 14887 40 24M = 14879 161 CCGGAGACTTAAATACATGAAGAA 555555&5555555545!555555 LB:Z:/data2/bsi/reference/sequence/human/ncbi/37.1/indexed/allchr.nix MC:Z:4S97M BD:Z:MMNOPQOQOOMNFOMPORRQPPQQ MD:Z:89G6 PG:Z:novoalign.7.F RG:Z:s_A13501 BI:Z:PPOQTSSTSQRPKSRSRTQSTTTT AM:i:70 NM:i:1 SM:i:70 MQ:i:40 PQ:i:72 UQ:i:47 AS:i:47
    R0211812:404:C5LHUACXX:3:2101:7330:33771 83 chr1 14906 70 45M = 14851 -156 AGGAAAAAGGCAGGACAGAATTACGAGGTGCTGGCCCAGGGCGGG 555555555555555555555555555555555555555555555 LB:Z:/data2/bsi/reference/sequence/human/ncbi/37.1/indexed/allchr.nix HC:i:51474884 MC:Z:101M BD:Z:PPOHJJPQQQRQQROQOOOPNOOOPPPMPQQQPQMQQPMPONMPP MD:Z:22A76 PG:Z:novoalign.6.D RG:Z:s_A13501 BI:Z:SRQLMMRTSRSSRTRSRQQSPSRQQSSRSTUTRSPRSSPRROPRR AM:i:70 NM:i:1 SM:i:70 MQ:i:70 PQ:i:120 UQ:i:60 AS:i:60
    R0211812:404:C5LHUACXX:3:2112:10053:16042 147 chr1 14909 53 42M = 14777 -233 AAAAAGGCAGGACAGAATTACAAGGTGCTGGCCCAGGGCGGG EFEDDIHKIGEDKFHEDFCDIEGJHFJGEIIIGE>IIIEIII LB:Z:/data2/bsi/reference/sequence/human/ncbi/37.1/indexed/allchr.nix MC:Z:101M BD:Z:HHHNRRQRQQRORPPPPOPNQNPPMPQQQPQMQQPMPONMPP MD:Z:101 PG:Z:novoalign.7.F RG:Z:s_A13501 BI:Z:LLLQTRRTTRUSTSQQSPSSRQSSRSTUTRSQRSSPRROPRR AM:i:70 NM:i:0 SM:i:70 MQ:i:53 PQ:i:4 UQ:i:0 AS:i:0
    R0211812:404:C5LHUACXX:3:1314:17709:60870 147 chr1 14936 29 15M = 14793 -244 CTGGCCCAGGGCGGG FFJHGIKFJJJFJJJ LB:Z:/data2/bsi/reference/sequence/human/ncbi/37.1/indexed/allchr.nix MC:Z:98M3S BD:Z:QQPQOSRQNQPONQQ MD:Z:101 PG:Z:novoalign.6.D RG:Z:s_A13501 BI:Z:UTRSRRSTQRSPQSR AM:i:70 NM:i:0 SM:i:70 MQ:i:29 PQ:i:23 UQ:i:5 AS:i:5

  • SheilaSheila Broad InstituteMember, Broadie admin


    I meant can you please attach the IGV screenshot of the bamout file? Also, before you attach it, can you right click on the reads and click on "Color alignments by > Sample"?


  • sbahetisbaheti Member

    i am sorry i thought you want to look at the reads, here is the snapshot of IGV with bamout BAM and original BAM file.

  • SheilaSheila Broad InstituteMember, Broadie admin


    Hi Saurabh,

    Thanks. This is odd behavior, and it could potentially be a bug. If you can, please upload snippets of your bam files so we can test them locally. Instructions are here:


  • sbahetisbaheti Member

    i uploaded the snippet of the BAM file with the command run . tar ball name is "HCbug_Saurabh.tar.gz"

  • HasaniHasani GermanyMember
    edited January 2015

    Dear GATK team,

    probably this is a strait forward question. Could you please clarify what is the benifit of having the --dbsnp when calling variants besides the ids?
    I've selected random set of SNPs in my data, and the exact genotype, and non-ref allele is given. Something I'm wondering about, because my data is RNA-seq data, so how could that be?

    Thank you in advance!

  • SheilaSheila Broad InstituteMember, Broadie admin


    Hi Hasani,

    Is there an issue with the random set of SNPs you selected? The dbsnp file is only used to populate the ID column and is not used in calculations:


  • HasaniHasani GermanyMember

    No! They are random.

  • SheilaSheila Broad InstituteMember, Broadie admin


    Hi Hasani,

    Can you post a record of a site in question? I am not sure exactly what the issue is.


Sign In or Register to comment.