Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Location of variant in multi-sample calling

esbeneickhardtesbeneickhardt DenmarkMember
edited January 2015 in Ask the GATK team

Dear Ensembl

While using your best practices pipeline, using multisample calling, I get these multi-allelic variants. As I am interested in the precise position of certain variants, I would like to know if there is a way to identify, where a variant is located. This is ofcause possible in most cases, but I have a subset of my variants, where I cannot see how this can be done

Examples from my VCF-file:

17 8045028 . CTTTTTTCTCCCCCTTGAACTTGAGCTCAATTCT CTTTTTCTCCCCCTTGAACTTGAGCTCAATTCT,C

9 32986030 . TAAAAAAAAAACAAAAAAAAAAAC TAAAAAAAAACAAAAAAAAAAAC,TAAAAAAAAAC,T,AAAAAAAAAAACAAAAAAAAAAAC

In the first example, I cannot see which "T" has been deleted - this could be any of them:

CTTTTTTCTCCCCCTTGAACTTGAGCTCAATTCT

CTTTTTCTCCCCCTTGAACTTGAGCTCAATTCT

In the second example, I cannot see which "A" has been deleted:

TAAAAAAAAAACAAAAAAAAAAAC

TAAAAAAAAACAAAAAAAAAAAC

Is there any way, I can get information on which one it is?

Cheers
Esben Eickhardt

Answers

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin
    edited January 2015

    @esbeneickhardt‌

    Hi Esben,

    There is no way to know for certain, biologically, which nucleotide is "missing". In effect, it does not matter because the result is the same either way. The way we deal with this is we use conventions such as left-aligning, which basically says that anytime this case occurs, we consider that it is the leftmost base that is the deleted one.

    -Sheila

Sign In or Register to comment.