Attention:
The frontline support team will be slow on the forum because we are occupied with the GATK Workshop on March 21st and 22nd 2019. We will be back and more available to answer questions on the forum on March 25th 2019.

Mutect2 output not match to real situation

mscjuliamscjulia United StatesMember

Hello,

I used Mutect2 to call variants on a pair of tumor and normal samples. One variant "PASS" the filter is shown below:

4   6956086 .   C   CTTTCTTGCT  .   PASS    ECNT=1;HCNT=34;MAX_ED=.;MIN_ED=.;NLOD=54.49;RPA=1,2;RU=TTTCTTGCT;STR;TLOD=17.08 GT:AD:AF:ALT_F1R2:ALT_F2R1:FOXOG:QSS:REF_F1R2:REF_F2R1  0/0:543,19:4.673e-03:0:0:.:9520,0:163:122

To my limited understanding of Mutect2 output, I think passing the filter means that "CTTTCTTGCT" is in tumor, not normal. I am trying to locate this small insertion event, and I attached an screenshot of the BQSR bam file, with the variant in the middle of the sequence. Here is one read I got from the tumor sample's sam file. Overall, there is a C to T mutation, which also occurs in the normal sample (not shown), but I do not see this insertion when comparing to the reference

ST-E00545:65:HJLYWALXX:7:1221:18061:39844       83      4       6956047 60     150M     =       6955995 -202    CGCTCCTGTTCATGGACAGGTTTGTGGCTGCTTTCTTGCTTTTCTTGCTGTTGGAACTGGAGACTTAACTGGAAGCAGAGTCTTTCCTGCGTGTAGCTTTGACAGCATGTGACCGTCGGCCTTGGTTGGGCTGAGGTGTTTCTGTGGGTC  JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA  NM:i:1  MD:Z:39C110     AS:i:145        XS:i:22 RG:Z:032017

The reference around chr4 6956096 is "CTTTCTTGCCTTTCTTGCT".

I am new to Mutect2 so I want to confirm with you experts about this. I understand that MuTect2 is still in beta testing stage, but I would really appreciate your advice. Thanks a lot!

Tagged:

Answers

Sign In or Register to comment.