Mutect2 output not match to real situation

mscjuliamscjulia United StatesMember

Hello,

I used Mutect2 to call variants on a pair of tumor and normal samples. One variant "PASS" the filter is shown below:

4   6956086 .   C   CTTTCTTGCT  .   PASS    ECNT=1;HCNT=34;MAX_ED=.;MIN_ED=.;NLOD=54.49;RPA=1,2;RU=TTTCTTGCT;STR;TLOD=17.08 GT:AD:AF:ALT_F1R2:ALT_F2R1:FOXOG:QSS:REF_F1R2:REF_F2R1  0/0:543,19:4.673e-03:0:0:.:9520,0:163:122

To my limited understanding of Mutect2 output, I think passing the filter means that "CTTTCTTGCT" is in tumor, not normal. I am trying to locate this small insertion event, and I attached an screenshot of the BQSR bam file, with the variant in the middle of the sequence. Here is one read I got from the tumor sample's sam file. Overall, there is a C to T mutation, which also occurs in the normal sample (not shown), but I do not see this insertion when comparing to the reference

ST-E00545:65:HJLYWALXX:7:1221:18061:39844       83      4       6956047 60     150M     =       6955995 -202    CGCTCCTGTTCATGGACAGGTTTGTGGCTGCTTTCTTGCTTTTCTTGCTGTTGGAACTGGAGACTTAACTGGAAGCAGAGTCTTTCCTGCGTGTAGCTTTGACAGCATGTGACCGTCGGCCTTGGTTGGGCTGAGGTGTTTCTGTGGGTC  JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA  NM:i:1  MD:Z:39C110     AS:i:145        XS:i:22 RG:Z:032017

The reference around chr4 6956096 is "CTTTCTTGCCTTTCTTGCT".

I am new to Mutect2 so I want to confirm with you experts about this. I understand that MuTect2 is still in beta testing stage, but I would really appreciate your advice. Thanks a lot!

Tagged:

Answers

Sign In or Register to comment.