We've moved!
This site is now read-only. You can find our new documentation site and support forum for posting questions here.
Be sure to read our welcome blog!

HaplotypeCaller v3.7.0 alternative allele depth not emitted


I just noticed the alternative allele read depth is missing for a true positive insertion called with HaplotypeCaller v3.7.0.

#SNPs and Indels GVCF with Haplotypecaller /share/apps/jre-distros/jre1.8.0_101/bin/java -Djava.io.tmpdir=/state/partition1/tmpdir -Xmx4g -jar /share/apps/GATK-distros/GATK_3.7.0/GenomeAnalysisTK.jar \ -T HaplotypeCaller \ -R /state/partition1/db/human/gatk/2.8/b37/human_g1k_v37.fasta \ -I "$seqId"_"$sampleId".bam \ -L /data/diagnostics/pipelines/GermlineEnrichment/GermlineEnrichment-"$version"/"$panel"/"$panel"_ROI_b37.bed \ -o "$seqId"_"$sampleId".g.vcf \ --genotyping_mode DISCOVERY \ --emitRefConfidence GVCF \ -dt NONE


#Joint genotyping /share/apps/jre-distros/jre1.8.0_101/bin/java -Djava.io.tmpdir=/state/partition1/tmpdir -Xmx16g -jar /share/apps/GATK-distros/GATK_3.7.0/GenomeAnalysisTK.jar \ -T GenotypeGVCFs \ -R /state/partition1/db/human/gatk/2.8/b37/human_g1k_v37.fasta \ -V GVCFs.list \ -L /data/diagnostics/pipelines/GermlineEnrichment/GermlineEnrichment-"$version"/"$panel"/"$panel"_ROI_b37.bed \ -o "$seqId"_variants.vcf \ -dt NONE

17 29652953 . A AGCAATCGCTTTAAAACAGACTTTCTCTCTAAGTGGTTTGTTGTTTTTCCTGGCTTTGCTTACGACAACGTCTCCGCAGTCTATATCTATAACTGTAACCCCT 789.40 PASS AC=1;AF=0.022;AN=46;DP=1476;ExcessHet=3.0103;FS=0;InbreedingCoeff=-0.0268;MLEAC=1;MLEAF=0.022;MQ=60;QD=29.24;SOR=0.627;set=variant2 GT:AD:DP:FT:GQ:PL 0/1:27,0:27:PASS:99:835,0,1107

The GT is HET but the AD field is 27,0 and IGV confirms there are mutant reads. However, the call has been identified from reassembled soft-clipped bases (no reads had insertion in the CIGAR) which might explain the miss count?


Issue · Github
by Sheila

Issue Number
Last Updated


Sign In or Register to comment.