Hi GATK Users,

Happy Thanksgiving!
Our staff will be observing the holiday and will be unavailable from 22nd to 25th November. This will cause a delay in reaching out to you and answering your questions immediately. Rest assured we will get back to it on Monday November 26th. We are grateful for your support and patience.
Have a great holiday everyone!!!

Regards
GATK Staff

HaplotypeCaller v3.7.0 alternative allele depth not emitted

Hi

I just noticed the alternative allele read depth is missing for a true positive insertion called with HaplotypeCaller v3.7.0.

#SNPs and Indels GVCF with Haplotypecaller /share/apps/jre-distros/jre1.8.0_101/bin/java -Djava.io.tmpdir=/state/partition1/tmpdir -Xmx4g -jar /share/apps/GATK-distros/GATK_3.7.0/GenomeAnalysisTK.jar \ -T HaplotypeCaller \ -R /state/partition1/db/human/gatk/2.8/b37/human_g1k_v37.fasta \ -I "$seqId"_"$sampleId".bam \ -L /data/diagnostics/pipelines/GermlineEnrichment/GermlineEnrichment-"$version"/"$panel"/"$panel"_ROI_b37.bed \ -o "$seqId"_"$sampleId".g.vcf \ --genotyping_mode DISCOVERY \ --emitRefConfidence GVCF \ -dt NONE

17 29652953 . A AGCAATCGCTTTAAAACAGACTTTCTCTCTAAGTGGTTTGTTGTTTTTCCTGGCTTTGCTTACGACAACGTCTCCGCAGTCAATATCTATAACTGTAACCCCT,AGCAATCGCTTTAAAACAGACTTTCTCTCTAAGTGGTTTGTTGTTTTTCCTGGCTTTGCTTACGACAACGTCTCCGCAGTCTATATCTATAACTGTAACCCCT,AGCAATTGCTTTAAAACAGACTTTCTCTCTAAGTGGTTTGTTGTTTTTCCTGGCTTTGCTTACGACAACGTCTCCGCAGTCAATATCTATAACTGTAACCCCT,AGCAATTGCTTTAAAACAGACTTTCTCTCTAAGTGGTTTGTTGTTTTTCCTGGCTTTGCTTACGACAACGTCTCCGCAGTCTATATCTATAACTGTAACCCCT,<NON_REF> 797.73 . DP=201;ExcessHet=3.0103;MLEAC=0,1,0,0,0;MLEAF=0.00,0.500,0.00,0.00,0.00;RAW_MQ=723600.00 GT:AD:DP:GQ:PL:SB 0/2:27,0,0,0,0,0:27:99:835,899,4231,0,1396,1107,1142,4659,1658,7755,460,3483,1580,5832,5549,1313,4448,1690,5857,4740,5617:13,14,0,0

#Joint genotyping /share/apps/jre-distros/jre1.8.0_101/bin/java -Djava.io.tmpdir=/state/partition1/tmpdir -Xmx16g -jar /share/apps/GATK-distros/GATK_3.7.0/GenomeAnalysisTK.jar \ -T GenotypeGVCFs \ -R /state/partition1/db/human/gatk/2.8/b37/human_g1k_v37.fasta \ -V GVCFs.list \ -L /data/diagnostics/pipelines/GermlineEnrichment/GermlineEnrichment-"$version"/"$panel"/"$panel"_ROI_b37.bed \ -o "$seqId"_variants.vcf \ -dt NONE

17 29652953 . A AGCAATCGCTTTAAAACAGACTTTCTCTCTAAGTGGTTTGTTGTTTTTCCTGGCTTTGCTTACGACAACGTCTCCGCAGTCTATATCTATAACTGTAACCCCT 789.40 PASS AC=1;AF=0.022;AN=46;DP=1476;ExcessHet=3.0103;FS=0;InbreedingCoeff=-0.0268;MLEAC=1;MLEAF=0.022;MQ=60;QD=29.24;SOR=0.627;set=variant2 GT:AD:DP:FT:GQ:PL 0/1:27,0:27:PASS:99:835,0,1107

The GT is HET but the AD field is 27,0 and IGV confirms there are mutant reads. However, the call has been identified from reassembled soft-clipped bases (no reads had insertion in the CIGAR) which might explain the miss count?

Thanks
Matt

Issue · Github
by Sheila

Issue Number
1826
State
open
Last Updated
Assignee
Array
Milestone
Array

Answers

Sign In or Register to comment.