Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

A question about using GenomeAnalysisTK to deal with ancient DNA data

Hi,
Because my data is ancient DNA,the read depth is almost one.When I used HaplotypeCaller to make gvcf,one read is as follows:
'''
REF: GTTATGTGTGTGTGTGGTGTGATGTGTGTGTGGTGTGATGTGTGTGTAGGGGTGTGTGTGGTGTGATGTGTGTGTAGAGG
ALT : GTGATGTGTGTGTGTGGTGTGATGTGTGTGTGGTGTGATGTGTGTGTAGGGGTGTGTGTGGTGTGATGTGTG-GCGGAGG
'''
The corresponding area in gvcf is as follows:
'''
1 4809 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4810 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4811 . T . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4812 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4813 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4814 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4815 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4816 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4817 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4818 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4819 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4820 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4821 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4822 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4823 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4824 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4825 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4826 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4827 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4828 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4829 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4830 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4831 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4832 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4833 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4834 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4835 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4836 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4837 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4838 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4839 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4840 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4841 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4842 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4843 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4844 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4845 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4846 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4847 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4848 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4849 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4850 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4851 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4852 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4853 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4854 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4855 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4856 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4857 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4858 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4859 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4860 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4861 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4862 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4863 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4864 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4865 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4866 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4867 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4868 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4869 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4870 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4871 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4872 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4873 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4874 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4875 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4876 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4877 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4878 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4879 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4880 . G . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4881 . T . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4882 . G . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4883 . T . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4884 . A . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4885 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4886 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4887 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4888 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
'''
My command is:
'''
java -jar GenomeAnalysisTK.jar -R myref.fa -T HaplotypeCaller -ERC BP_RESOLUTION -I my.bam -o out.g.vcf.gz
'''

the quality of every site is the same,why GQ and PL changed from site 「1-4865」 ?
and in site 「1-4880」,「1-4881」,「1-4882」,the AD should be 「1,0」,「0,0」,「1,0」,why it's wrong in gvcf ?
and in the next step,I want to keep the variants with DP=1 in '1/1' ,How should I do ?

Thanks!

Answers

Sign In or Register to comment.