A question about using GenomeAnalysisTK to deal with ancient DNA data

Hi,
Because my data is ancient DNA,the read depth is almost one.When I used HaplotypeCaller to make gvcf,one read is as follows:
'''
REF: GTTATGTGTGTGTGTGGTGTGATGTGTGTGTGGTGTGATGTGTGTGTAGGGGTGTGTGTGGTGTGATGTGTGTGTAGAGG
ALT : GTGATGTGTGTGTGTGGTGTGATGTGTGTGTGGTGTGATGTGTGTGTAGGGGTGTGTGTGGTGTGATGTGTG-GCGGAGG
'''
The corresponding area in gvcf is as follows:
'''
1 4809 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4810 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4811 . T . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4812 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4813 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4814 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4815 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4816 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4817 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4818 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4819 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4820 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4821 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4822 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4823 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4824 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4825 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4826 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4827 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4828 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4829 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4830 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4831 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4832 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4833 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4834 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4835 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4836 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4837 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4838 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4839 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4840 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4841 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4842 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4843 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4844 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4845 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4846 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4847 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4848 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4849 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4850 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4851 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4852 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4853 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4854 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4855 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4856 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4857 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4858 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4859 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4860 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4861 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4862 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4863 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4864 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,45
1 4865 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4866 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4867 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4868 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4869 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4870 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4871 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4872 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4873 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4874 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4875 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4876 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4877 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4878 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4879 . T . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4880 . G . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4881 . T . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4882 . G . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4883 . T . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4884 . A . . . GT:AD:DP:GQ:PL 0/0:0,1:1:0:0,0,0
1 4885 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4886 . A . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4887 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
1 4888 . G . . . GT:AD:DP:GQ:PL 0/0:1,0:1:0:0,0,0
'''
My command is:
'''
java -jar GenomeAnalysisTK.jar -R myref.fa -T HaplotypeCaller -ERC BP_RESOLUTION -I my.bam -o out.g.vcf.gz
'''

the quality of every site is the same,why GQ and PL changed from site 「1-4865」 ?
and in site 「1-4880」,「1-4881」,「1-4882」,the AD should be 「1,0」,「0,0」,「1,0」,why it's wrong in gvcf ?
and in the next step,I want to keep the variants with DP=1 in '1/1' ,How should I do ?

Thanks!

Answers

Sign In or Register to comment.