We've moved!
This site is now read-only. You can find our new documentation site and support forum for posting questions here.
Be sure to read our welcome blog!

Error parsing text SAM file. Empty sequence dictionary.; File rRNA_mapped.sam; Line 1

I am trying to remove rRNA sequences from my fastq files. I built the rRNA index file with bowtie-build, then mapped my reads to the index file producing .sam files. Then used: samtools view -f 4 rRNA.sam > rRNA_unmapped.sam, samtools view -F 4 rRNA.sam > rRNA_mapped.sam
Now I am trying to convert the sam files to fastq. I am getting this error:

Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing text SAM file. Empty sequence dictionary.; File rRNA_mapped.sam; Line 1
Line: 2265:2:1101:1080:1987/2 0 HM991685 292 255 98M * 0 0 TTCTACGAGTCGAGTTGCTTGGGATTGCAGCTCAAATTTGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGGGATACCGATAGTGCACAAGTACCG aceeeegggeghhihhiiiihiifghafhhhhifhiiihiifhgeghhiffhhhihhhihhiiihifgfggdeeccdddccacaabbbccccabbcba XA:i:0 MD:Z:98 NM:i:0
at htsjdk.samtools.SAMLineParser.reportErrorParsingLine(SAMLineParser.java:439)
at htsjdk.samtools.SAMLineParser.parseLine(SAMLineParser.java:341)
at htsjdk.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:248)
at htsjdk.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:236)
at htsjdk.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:212)
at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:545)
at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:519)
at picard.sam.SamToFastq.doWork(SamToFastq.java:169)
at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:209)
at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:95)
at picard.cmdline.PicardCommandLine.main(PicardCommandLine.java:105)

What should I do?

Issue · Github
by Sheila

Issue Number
1476
State
closed
Last Updated
Assignee
Array
Milestone
Array
Closed By
vdauwera

Answers

Sign In or Register to comment.