If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra

Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

MarkDuplicates---“did not start with a parseable number”

I was running RNA-seq data through the MarkDuplicates in Picard package for SNP calling getting the message:

WARNING 2016-08-31 16:48:12 AbstractOpticalDuplicateFinderCommandLineProgram A field field parsed out of a read name was expected to contain an integer and did not. Read name: SN1001:449:HGTN3ADXX:1:2115:4606:89966:R2#1#CTCCT. Cause: String 'R2#1#CTCCT' did not start with a parsable number.

Then I run the command:

samtools view resources/HepG2.RBFOX2/HepG2.RBFOX2.rep2.R2.tag.uniq.sorted.bam | grep R2#1#CTCCT

And I got this:

SN1001:449:HGTN3ADXX:2:2110:11231:12370:R2#1#CTCCT 16 chrX 133035777 37 31M * 0 0 TTTTTGAGTTAAAGTTATACACCTGAAGAGG BFFBFB

So I tried to run the command ValidateSamFile

ERROR: Record 2243391, Read name SN1001:449:HGTN3ADXX:1:1207:18758:88057:R2#2#TATAT, NM tag (nucleotide differences) in file [2] does not match reality [6]
ERROR: Record 2500598, Read name SN1001:449:HGTN3ADXX:2:1206:6729:26515:R2#1#TAATC, NM tag (nucleotide differences) in file [3] does not match reality [7]
ERROR: Record 2500599, Read name SN1001:449:HGTN3ADXX:2:2110:7481:90889:R2#1#TTCAG, NM tag (nucleotide differences) in file [3] does not match reality [8]
ERROR: Record 2500601, Read name SN1001:449:HGTN3ADXX:1:1210:6384:54132:R2#1#TAGAT, NM tag (nucleotide differences) in file [3] does not match reality [9]
ERROR: Record 2500602, Read name SN1001:449:HGTN3ADXX:2:2111:15383:87620:R2#1#GGGGG, NM tag (nucleotide differences) in file [3] does not match reality [9]
ERROR: Record 2500603, Read name SN1001:449:HGTN3ADXX:2:2212:9564:100522:R2#1#GGCGC, NM tag (nucleotide differences) in file [3] does not match reality [10]
ERROR: Record 2500604, Read name SN1001:449:HGTN3ADXX:1:2110:14050:67425:R2#1#GGCCC, NM tag (nucleotide differences) in file [2] does not match reality [9]
ERROR: Record 2500605, Read name SN1001:449:HGTN3ADXX:1:2205:20926:12488:R2#1#TCCCC, NM tag (nucleotide differences) in file [1] does not match reality [3]
ERROR: Record 2500606, Read name SN1001:449:HGTN3ADXX:2:2109:8561:77192:R2#1#CCCCC, NM tag (nucleotide differences) in file [1] does not match reality [3]

Does this warning message matters?


  • zillurbmb51zillurbmb51 USAMember
    edited May 2017

    Hi there,
    I have the same problem. I tried with ValidateSamFile and getting the following:

    [[email protected] pberghei]$ java -jar /gondor/zillur/tools/picard.jar ValidateSamFile I=SRR1858992_gca.sorted.bam MODE=SUMMARY
    [Tue May 16 12:55:00 EDT 2017] Executing as [email protected] on Linux 3.10.0-514.16.1.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_131-b11; Picard version: 2.9.0-1-gf5b9f50-SNAPSHOT
    [Tue May 16 12:55:14 EDT 2017] picard.sam.ValidateSamFile done. Elapsed time: 0.25 minutes.
    To get help, see
    Exception in thread "main" htsjdk.samtools.SAMException: /tmp/zillur/CSPI.1880274338990258510.tmp/5847.tmpnot found
        at htsjdk.samtools.util.FileAppendStreamLRUCache$Functor.makeValue(
        at htsjdk.samtools.util.FileAppendStreamLRUCache$Functor.makeValue(
        at htsjdk.samtools.util.ResourceLimitedMap.get(
        at htsjdk.samtools.CoordinateSortedPairInfoMap.getOutputStreamForSequence(
        at htsjdk.samtools.CoordinateSortedPairInfoMap.put(
        at htsjdk.samtools.SamFileValidator$CoordinateSortedPairEndInfoMap.put(
        at htsjdk.samtools.SamFileValidator.validateMateFields(
        at htsjdk.samtools.SamFileValidator.validateSamRecordsAndQualityFormat(
        at htsjdk.samtools.SamFileValidator.validateSamFile(
        at htsjdk.samtools.SamFileValidator.validateSamFileSummary(
        at picard.sam.ValidateSamFile.doWork(
        at picard.cmdline.CommandLineProgram.instanceMain(
        at picard.cmdline.PicardCommandLine.instanceMain(
        at picard.cmdline.PicardCommandLine.main(
    Caused by: /tmp/zillur/CSPI.1880274338990258510.tmp/5847.tmp (Too many open files)
        at Method)
        at htsjdk.samtools.util.FileAppendStreamLRUCache$Functor.makeValue(
        ... 13 more

    What does it mean? The problem still persists. Thanks in advance. Waiting for your suggestions.

    Best regards

    Post edited by shlee on
Sign In or Register to comment.