To celebrate the release of GATK 4.0, we are giving away free credits for running the GATK4 Best Practices pipelines in FireCloud, our secure online analysis portal. It’s first come first serve, so sign up now to claim your free credits worth $250. Sponsored by Google Cloud. Learn more at https://software.broadinstitute.org/firecloud/documentation/freecredits

FastaAlternateReferenceMaker leaving out verified SNPs from FASTA file

I have Illlumina sequenced genomes that I have aligned using BWA and GATK to a section of a genome that I am interested in. When I examine the .bam file and the VCF file generated in IGV I can clearly see a single T in the middle of the sequence (which is an incredibly important location for the protein function)

However, when I run the FastaAlternateReferenceMaker on it as such:
java -Xmx4G -Djava.io.tmpdir=$tempdir -jar $GA -R $Tgindex -T VariantFiltration --variant CTG.ROP38.raw.snps.indels.vcf -filter "QD < 2.0" -filterName "SNP_filter" -o CTG.ROP38.snps.filter.vcf
java -Xmx4G -Djava.io.tmpdir=$tempdir -jar $GA -R $Tgindex -T SelectVariants --variant CTG.ROP38.snps.filter.vcf -o CTG.ROP38.snps.select.vcf -env -ef
java -Xmx4G -Djava.io.tmpdir=$tempdir -jar $GA -R $Tgindex -T FastaAlternateReferenceMaker --variant CTG.ROP38.snps.select.vcf -o CTG.ROP38.raw.snps.indels.vcf_071516.fasta

I do not get the T in my sequence, even though the SNP has a PASS in the FILTER column
VCF at 5070:
TGME49_242110 5070 . A T, 3024.77 PASS DP=75;MLEAC=2,0;MLEAF=1.00,0.00;MQ=60.00 GT:AD:DP:GQ:PL:SB 1/1:0,75,0:75:99:3053,225,0,3053,225,3053:0,0,45,30

Fasta:
ATAGAATGCCACCTGAGTGACCGGTGTGTTGCTCAT
GAGTGACC should be GTGTGACC

I don't understand why I'm not getting the appropriate SNP from this VCF as this process has worked well for me in the past. Please help.

Sign In or Register to comment.