FastaAlternateReferenceMaker leaving out verified SNPs from FASTA file

I have Illlumina sequenced genomes that I have aligned using BWA and GATK to a section of a genome that I am interested in. When I examine the .bam file and the VCF file generated in IGV I can clearly see a single T in the middle of the sequence (which is an incredibly important location for the protein function)

However, when I run the FastaAlternateReferenceMaker on it as such:
java -Xmx4G -Djava.io.tmpdir=$tempdir -jar $GA -R $Tgindex -T VariantFiltration --variant CTG.ROP38.raw.snps.indels.vcf -filter "QD < 2.0" -filterName "SNP_filter" -o CTG.ROP38.snps.filter.vcf
java -Xmx4G -Djava.io.tmpdir=$tempdir -jar $GA -R $Tgindex -T SelectVariants --variant CTG.ROP38.snps.filter.vcf -o CTG.ROP38.snps.select.vcf -env -ef
java -Xmx4G -Djava.io.tmpdir=$tempdir -jar $GA -R $Tgindex -T FastaAlternateReferenceMaker --variant CTG.ROP38.snps.select.vcf -o CTG.ROP38.raw.snps.indels.vcf_071516.fasta

I do not get the T in my sequence, even though the SNP has a PASS in the FILTER column
VCF at 5070:
TGME49_242110 5070 . A T, 3024.77 PASS DP=75;MLEAC=2,0;MLEAF=1.00,0.00;MQ=60.00 GT:AD:DP:GQ:PL:SB 1/1:0,75,0:75:99:3053,225,0,3053,225,3053:0,0,45,30

Fasta:
ATAGAATGCCACCTGAGTGACCGGTGTGTTGCTCAT
GAGTGACC should be GTGTGACC

I don't understand why I'm not getting the appropriate SNP from this VCF as this process has worked well for me in the past. Please help.

Sign In or Register to comment.