Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

gVCF ALT Allele "*"

dmb107dmb107 MIamiMember
edited May 2016 in Ask the GATK team

Hi,

I have noticed that most of my alternate alleles are followed by a "*" allele. In the following example, the GT is 0/6 which seems to correspond to REF/*.

For example:
chr7 54646419 . GCCGGACCCTGTTGGAGGAGGCTGGGTGGTTGCATGGTGCCGTGA GCCCGGACCCTGTTGGAGGAGGCTGGGTGGTTGCATGGTGCCGTGA,GTGTTGGAGGAGGCTGGGTGGTTGCATGGTGCCGTGA,GGGCTGGGTGG
TTGCATGGTGCCGTGA,GCGGACCCTGTTGGAGGAGGCTGGGTGGTTGCATGGTGCCGTGA,GACCGGACCCTGTTGGAGGAGGCTGGGTGGTTGCATGGTGCCGTGA,* 182245.29 GT:AD:DP:GQ:PL 0/6:840,0,0,0,0,0,73:917:99:170,2590,35627,2590,35627,35627,2590,35627,35627,35627,2590,35627,35627,35627,35627,2590,35627,35627,35627,35627,35627,0,33783,33783,33783,33783,33783,34747

How do I interpret these * alleles?

Thank you.

Post edited by dmb107 on
Tagged:

Best Answer

Answers

Sign In or Register to comment.