We've moved!
This site is now read-only. You can find our new documentation site and support forum for posting questions here.
Be sure to read our welcome blog!

vcf files of GATK UG empty

Hi,
my vcf files stay empty. I used this command line:

java -jar GenomeAnalysisTK.jar -I in_rg.sorted.bam -R hg19.fasta -T UnifiedGenotyper -stand_call_conf 50.0 -o out_gatk.vcf -S SILENT

The @RG line in the header is present

@RG ID:PP7LI.IonXpress_001 CN:TorrentServer/sn274670336 DT:2015-07-17T10:35:51 FO:TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGA KS:TCAGCTAAGGTAACGAT PG:tmap PL:IONTORRENT PU:Unspecified/314R/IonXpress_001 SM:MV411 CHSP FLT3

Could anyone help?
Thx, Yvonne

Answers

Sign In or Register to comment.