vcf files of GATK UG empty

Hi,
my vcf files stay empty. I used this command line:

java -jar GenomeAnalysisTK.jar -I in_rg.sorted.bam -R hg19.fasta -T UnifiedGenotyper -stand_call_conf 50.0 -o out_gatk.vcf -S SILENT

The @RG line in the header is present

@RG ID:PP7LI.IonXpress_001 CN:TorrentServer/sn274670336 DT:2015-07-17T10:35:51 FO:TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGA KS:TCAGCTAAGGTAACGAT PG:tmap PL:IONTORRENT PU:Unspecified/314R/IonXpress_001 SM:MV411 CHSP FLT3

Could anyone help?
Thx, Yvonne

Answers

Sign In or Register to comment.