MuTect2 INDEL accuracy

2nelly2nelly SwitzerlandMember

Hi all,
I was wondering for other people's opinion about the accuracy of MuTect2 regarding INDEL's detection.Are you satisfied?
No pitfall behind that, just wondering!!

Thank u in advance!

Answers

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie

    It's a fair question, and we'd love to get some feedback from the community on this.

  • Hi, I used mutect2 indel to call indel varaints and got some long insertions of more than 50 bp. I inspected the varaint with IGV, but got no reads with inserted bases, why? Beaside, I checked the varaint with samtools tview in bam file, also no reads were inserted with those bases. This confused me a lot, please help me with this problem.

    chr17 7579896
    G GCCGTCCTTTCATGCTAGACTAAGAAGAGTTCTCAGTAATTTTTTTGTGTTGTGTGTATTCAACTCACAGAGTTGA
    N GT:AD:AF:F1R2:F2R1:MBQ:MFRL:MMQ:MPOS:SA_MAP_AF:SA_POST_PROB
    0/0:62,0:0.012:36,0:26,0:0:188,0:0:0
    T GT:AD:AF:F1R2:F2R1:MBQ:MFRL:MMQ:MPOS:SA_MAP_AF:SA_POST_PROB
    0/1:114,16:0.126:54,11:60,5:36:147,90:60:0:0.101,0.111,0.123:0.020,6.027e-03,0.9740.123076923
    TP53
    c.16_17insTCAACTCTGTGAGTTGAATACACACAACACAAAAAAATTACTGAGAACTCTTCTTAGTCTAGCATGAAAGGACGG
    p.S6delinsFNSVSIHTTQKNYELFLV*HERTA
    stop_gained&conservative_inframe_insertion

  • SheilaSheila Broad InstituteMember, Broadie, Moderator

    @nulidexia
    Hi,

    Have you checked the bamout?

    -Sheila

Sign In or Register to comment.