Hi GATK Users,

Happy Thanksgiving!
Our staff will be observing the holiday and will be unavailable from 22nd to 25th November. This will cause a delay in reaching out to you and answering your questions immediately. Rest assured we will get back to it on Monday November 26th. We are grateful for your support and patience.
Have a great holiday everyone!!!

Regards
GATK Staff

MuTect2 INDEL accuracy

2nelly2nelly SwitzerlandMember

Hi all,
I was wondering for other people's opinion about the accuracy of MuTect2 regarding INDEL's detection.Are you satisfied?
No pitfall behind that, just wondering!!

Thank u in advance!

Answers

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    It's a fair question, and we'd love to get some feedback from the community on this.

  • Hi, I used mutect2 indel to call indel varaints and got some long insertions of more than 50 bp. I inspected the varaint with IGV, but got no reads with inserted bases, why? Beaside, I checked the varaint with samtools tview in bam file, also no reads were inserted with those bases. This confused me a lot, please help me with this problem.

    chr17 7579896
    G GCCGTCCTTTCATGCTAGACTAAGAAGAGTTCTCAGTAATTTTTTTGTGTTGTGTGTATTCAACTCACAGAGTTGA
    N GT:AD:AF:F1R2:F2R1:MBQ:MFRL:MMQ:MPOS:SA_MAP_AF:SA_POST_PROB
    0/0:62,0:0.012:36,0:26,0:0:188,0:0:0
    T GT:AD:AF:F1R2:F2R1:MBQ:MFRL:MMQ:MPOS:SA_MAP_AF:SA_POST_PROB
    0/1:114,16:0.126:54,11:60,5:36:147,90:60:0:0.101,0.111,0.123:0.020,6.027e-03,0.9740.123076923
    TP53
    c.16_17insTCAACTCTGTGAGTTGAATACACACAACACAAAAAAATTACTGAGAACTCTTCTTAGTCTAGCATGAAAGGACGG
    p.S6delinsFNSVSIHTTQKNYELFLV*HERTA
    stop_gained&conservative_inframe_insertion

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @nulidexia
    Hi,

    Have you checked the bamout?

    -Sheila

Sign In or Register to comment.