Picard Multi-Fasta Problem

ValjaValja GermanyMember


I have a problem running Picard's CollectAlignmentSummaryMetrics: I aligned Illumina paired-end reads (processed with Trimmomatic) against a genome from NCBI RefSeq (GCF_000187205.2_ASM18720v4) using BWA (bwa-0.7.8). The reference is a multifasta with NC_017847, NC_017848 and NC_020524. Then a SAM file was created and I called Picard's SortSam, MarkDuplicates and CollectAlignmentSummaryMetrics:

java -jar picard-tools-1.119/SortSam.jar INPUT=mapped.sam OUTPUT=mapped_sorted.bam SORT_ORDER=coordinate VALIDATION_STRINGENCY=LENIENT
java -jar picard-tools-1.119/MarkDuplicates.jar INPUT=mapped_sorted.bam METRICS_FILE=dedup_metrics.txt OUTPUT=mapped_sorted_dedup.bam VALIDATION_STRINGENCY=LENIENT
java -jar picard-tools-1.119/CollectAlignmentSummaryMetrics.jar INPUT=mapped_sorted_dedup.bam R=GCF_000187205.2_ASM18720v4.fa O=alignment_metrics.txt VALIDATION_STRINGENCY=LENIENT

The error is Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: -1 after calling CollectAlignmentSummaryMetrics. So, I thought it would be a good idea to check the SAM file, ran

java -jar picard-tools-1.119/ValidateSamFile.jar I=mapped_sorted_dedup.bam REFERENCE_SEQUENCE=GCF_000187205.2_ASM18720v4.fa

and got
ERROR: Record 1, Read name HWI-ST751:181:C3VLMACXX:3:2106:15520:100263, Mate Alignment start should != 0 because reference name != *. ERROR: Record 1, Read name HWI-ST751:181:C3VLMACXX:3:2106:15520:100263, Alignment start should != 0 because reference name != *. [...] Exception in thread "main" htsjdk.samtools.SAMException: Exception counting mismatches for read HWI-ST751:181:C3VLMACXX:3:2106:15520:100263 1/2 101b aligned read.

Removing this read and another two reads causing the same error from the BAM file finally worked. These problematic reads have the following entries in the BAM file:

HWI-ST751:181:C3VLMACXX:3:1205:16810:95215 113 NC_017847 0 37 97M NC_020524 18 0 CCGCTGAAACGGAGTTTTTGTACCTTAATAGGCTTTCAAAGCATTTATTAGCAATCGTTTCAGGCCCTCTAAAAGAAAAAAAGAAAAGATTTTAAAT 5.:;@:9CB<>@>>?;(>[email protected]?76CHEHFIHGHHF;HCFF=4B9;GHE?GAB???::)9GEE>[email protected]>GDD>FD:[email protected]@; X0:i:1 X1:i:0 MD:Z:0 PG:Z:MarkDuplicates RG:Z:C5120-5141_R XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:1 XO:i:0 XT:A:U HWI-ST751:181:C3VLMACXX:3:1205:16810:95215 177 NC_020524 18 37 101M NC_017847 0 0 TTTAACGGTACAAAAAGTTTTAATTACGGTACAAATATTCCTTTTTAACGGTACAAAAATTCTGGCCTTTAATTTCAATAGCTTAAAAGGTACAAAAATTC A8<<,;:3A?8ABBA>>CBBDB?<DDFFEC;FEFEE>[email protected]>[email protected]?99?6IEFFFBF=FBC:<[email protected]?B:DB:<? X0:i:1 X1:i:0 MD:Z:101 PG:Z:MarkDuplicates RG:Z:C5120-5141_R XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 XT:A:U


As far as I can see, I would say that the problem is that the reads are mapped to different reference sequences (at least the two last ones). Is there a way to avoid this problem when using Picard?

Thanks in advance!



  • ValjaValja GermanyMember

    After updating all used tools to their newest version there are no errors or exceptions any more. At least for this reference genome and the used sample.

    Just in case someone needs it: The following software versions worked for me:
    bwa-0.7.12 samtools-1.2 picard-tools-1.119 GenomeAnalysisTK-3.5

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Glad to hear your problem was solved by upgrading to the latest versions!

Sign In or Register to comment.