The Frontline Support team will be offline February 18 for President's Day but will be back February 19th. Thank you for your patience as we get to all of your questions!
DP for INDEL is more than 100 and AD is 0

Hi all,
I have the below INDEL call from GATK-3.3 Haplotype caller.
chr17 39190954 . G GCAGCAGCTTGGCTGGCAGCAGCTGGTCTCA 770.52 PASS AC=1;AF=0.500;AN=2;DP=138;
FS=0.000;MLEAC=1;MLEAF=0.500;MQ=58.33;MQ0=0;QD=5.58;SOR=0.693 GT:AD:DP:GQ:PL 0/1:0,0:0:7:807,0,7
The command used:
java -Xmx10G -jar GenomeAnalysisTK.jar -R %s -T HaplotypeCaller -I %s -L %s -stand_emit_conf 10 -stand_call_conf 30
--genotyping_mode DISCOVERY -o %s
DP in the INFO field is 138 and AD from the FORMAT field is 0,0. I understand that DP and AD are unfiltered and filtered depths. However, having 0 reads is something alarming. Could someone help me to understand the differing read depths.
Best Answer
-
Sheila Broad Institute admin
@mehar
Hi,Have a look at this page for more information: https://www.broadinstitute.org/gatk/guide/tooldocs/org_broadinstitute_gatk_tools_walkers_annotator_Coverage.php
The 138 reads must have been filtered by Haplotype Caller.
You can inspect the reads in IGV and also have a look at the bamout file. http://gatkforums.broadinstitute.org/discussion/5484/howto-generate-a-bamout-file-showing-how-haplotypecaller-has-remapped-sequence-reads#latest-Sheila
Answers
@mehar
Hi,
Have a look at this page for more information: https://www.broadinstitute.org/gatk/guide/tooldocs/org_broadinstitute_gatk_tools_walkers_annotator_Coverage.php
The 138 reads must have been filtered by Haplotype Caller.
You can inspect the reads in IGV and also have a look at the bamout file. http://gatkforums.broadinstitute.org/discussion/5484/howto-generate-a-bamout-file-showing-how-haplotypecaller-has-remapped-sequence-reads#latest
-Sheila