Heads up:
We’re moving the GATK website, docs and forum to a new platform. Read the full story and breakdown of key changes on this blog.
Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.
Attention:
We will be out of the office for a Broad Institute event from Dec 10th to Dec 11th 2019. We will be back to monitor the GATK forum on Dec 12th 2019. In the meantime we encourage you to help out other community members with their queries.
Thank you for your patience!

what does "ContextCovariate" mean?

hi,
What does the covariate "ContextCovariate" in BQSR mean? Is it "reference sequence context" or "read context"? Is it the same with "Dinuc" in older versions of gatk?
Thanks a lot!

Best Answer

Answers

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    It refers to the reference sequence context. Dinuc was the dinucleotide context covariate, yes.

  • douymdouym Member
    edited November 2014

    Thanks for your reply, but I'am afraid it's not true. Yesterday I took a test, and the results indicate it refers to reads context.

    The test results are like this:

    1. cat reference.fasta |grep GT (7 "GT" in this region of referece sequence)

    ACACAATGTAGAATCAATAAATGATAATTCCGTAAGAATTCAGCAGTATGTACCATTAAGCAAAGTCGATCAAAAAGAGTTTGTTCCAATCCATTTTCATG

    1. cat test.recal.table |grep GT (2 reads covering this region, with a same mismatch from "GT" to "GC". If it refers to reference context, then there should be 14 "GT"s in recal_table, but there are only 12 "GT"s, as follows。)

      shu_family.64.L1 27 GT Context M 27.0000 1 0.00
      shu_family.64.L1 29 GT Context M 29.0000 1 0.00
      shu_family.64.L1 30 GT Context M 30.0000 1 0.00
      shu_family.64.L1 31 GT Context M 31.0000 4 0.00
      shu_family.64.L1 32 GT Context M 32.0000 4 0.00
      shu_family.64.L1 33 GT Context M 33.0000 1 0.00

    I think it's not very good to consider only reads contexts, because mutations come from reference contexts, and different reference contexts should have different mutation rates.

    Is there a co-variate in BQSR describing reference contexts? The on-line manual of GATK seems chaotic, and I cannot find that. If there is not a co-variate describing that, I think it will be worth to develop one.

    Best, Dou

    Post edited by Geraldine_VdAuwera on
  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Ah, my mistake, you're correct that it is the read context.

    Keep in mind that BQSR doesn't aim to model true mutations, it models technical bias in the instrument's output. For that purpose it makes more sense to look at read context, since that is what the instrument sees and processes. The idea is to ask "does the instrument make mistakes at specific places depending on e.g. what base it just read?". The reference context itself is not informative for answering this question.

  • douymdouym Member
    edited November 2014

    hi Geraldin,
    Thanks for your reply, but yet I cannot agree with you. You mentioned that the idea is to ask "does the instrument make mistakes at specific places depending on e.g. what base it just read", and it really puzzled me.

    First of all, it seems the instrument you mentioned has only one ability: reading read clusters. But as we all know, the NGS technology is very complicated. Take illumina for example, the whole sequencing procedure include library generation (adapter ligation, PCR amplification), cluster generation (library annealing, bridging amplification, cleavage and washing out one strand) and sequencing by synthesis. Reading read clusters is just the last step, and errors can come from all those procedures.

    What's more, even if we suppose that the "instrument" is only able to read read clusters, the "reads" we see finally are read out **of the instrument. I think we **cannot confirm "read in" is the same as "read out" . For example, if the true read cluster is "GAT" while the sequencing result is "GAC", what is the "read context"? I think it should be "GAT", but not "GAC".

    In conclusion, I think the context should be what are the real bases. The context should be a string of bases from the very start of sequencing, not necessarily "reference context", but can also be "major allele context". For example, if a read out is G(55)|A(1), A, C, then the read context should G, A, C.

    Best, Dou

Sign In or Register to comment.