Holiday Notice:
The Frontline Support team will be slow to respond December 17-18 due to an institute-wide retreat and offline December 22- January 1, while the institute is closed. Thank you for your patience during these next few weeks. Happy Holidays!

SplitNCigarReads exception

skenoyskenoy chinaMember
edited September 2014 in Ask the GATK team

my script :

java -jar ~/bin/gatk-3.2-2/GenomeAnalysisTK.jar -T SplitNCigarReads -R Gmax.fa -I NPB18L_mark.bam -o NPB18L_snc.bam -U ALLOW_N_CIGAR_READS -fixNDN

when i use -fixNDN, it will be:

java.lang.UnsupportedOperationException
at java.util.AbstractList.add(AbstractList.java:148)
at java.util.AbstractList.add(AbstractList.java:108)
at org.broadinstitute.gatk.tools.walkers.rnaseq.SplitNCigarReads.initialize(SplitNCigarReads.java:150)
at org.broadinstitute.gatk.engine.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:83)
at org.broadinstitute.gatk.engine.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:314)
at org.broadinstitute.gatk.engine.CommandLineExecutable.execute(CommandLineExecutable.java:121)
at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:248)
at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:155)
at org.broadinstitute.gatk.engine.CommandLineGATK.main(CommandLineGATK.java:107)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 3.2-2-gec30cee):
ERROR
ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
ERROR If not, please post the error message, with stack trace, to the GATK forum.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Code exception (see stack trace for error itself)

but i don't use -fixNDN, it will be:

ERROR ------------------------------------------------------------------------------------------
ERROR A USER ERROR has occurred (version 3.2-2-gec30cee):
ERROR
ERROR This means that one or more arguments or inputs in your command are incorrect.
ERROR The error message below tells you what is the problem.
ERROR
ERROR If the problem is an invalid argument, please check the online documentation guide
ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
ERROR
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
ERROR
ERROR MESSAGE: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 94M407N1D1033N6M

how can i fix it???

Post edited by skenoy on

Answers

  • skenoyskenoy chinaMember

    anyone knows?

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    @skenoy,

    Sorry for the late reply, we are traveling for a workshop. This looks like it may be a bug, would you be able to share a snippet of data that we can use to debug and fix it? Instructions are here: https://www.broadinstitute.org/gatk/guide/article?id=1894

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Actually, before you send us a snippet, please try again using the latest development build , which includes a fix for a bug in that tool.

  • @skenoy @Geraldine_VdAuwera‌ Any update regarding this bug? I tried with nightly-2014-10-13-gf24cf57 but no success.

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    @kisunpokharel As the original poster did not follow up with us, we never got a snippet to debug. If you can send us one we can get this fixed. Instructions are here: https://www.broadinstitute.org/gatk/guide/article?id=1894

  • @Geraldine_VdAuwera‌ I just uploaded snippet gatk_bug_kisun.txt.tar.gz. Thanks!

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @kisunpokharel‌

    Hi,

    Can you upload the sheep genome you are using?

    Thanks,
    Sheila

  • Hi @Sheila‌ I have uploaded the genome.

    Thanks, Kisun

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @kisunpokharel‌

    Hi Kisun,

    Sorry I just accidentally clicked No and it now says rejected answer to your post. Your answer is not rejected! I am not sure how to reverse this.

    I got the genome, and I am about to submit a bug report.

    I will let you know when this is fixed.

    -Sheila

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Rejection reversed (comment gear icon -> Q&A... -> "Don't know")

  • skenoyskenoy chinaMember

    @Geraldine_VdAuwera said:
    Actually, before you send us a snippet, please try again using the latest development build , which includes a fix for a bug in that tool.

    sorry about this, cause i had a long journey alone... do you fixed it?

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    @skenoy, did you test the latest nightly build?

  • lenkahlenkah Czech RepublicMember

    Hi,
    I've the very same problem as Kisun. I've tried the latest nightly-build, but it still doesn't work...
    Should I upload a snippet?

    Kisun, does the latest build work in your case?

    Thanks lenka

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @lenkah‌

    Hi Lenka,

    I have put in the Bug report for Kisun and will let you all know on this thread when it is fixed. There should be no need for you to submit your files, as I suspect Kisun's case will cover everyone's issue on this thread. Once I let you know this bug has been fixed, if it still does not work in your case, then I will ask you to submit your files.

    Thanks,
    Sheila

  • skenoyskenoy chinaMember

    @Geraldine_VdAuwera said:
    skenoy, did you test the latest nightly build?

    yes, but it don`t work... Should I upload a snippet continue?

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @skenoy‌

    Please see my answer to Lenka above.

    -Sheila

  • monicafabbromonicafabbro ArgentinaMember

    Hi everyone!!
    I'm working with RNAseq and i'm using the new RNAseq workflow.
    When I try the SplitNCigarReads, in one of my samples, i'm getting the same error message :

    ERROR MESSAGE: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 32M152N72M255N2D216N47M

    Have you find a solution for this? Or could anyone suggest me what can I do to fix it?

    Thanks in advance!
    MF

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @monicafabbro‌

    Hi MF,

    There is still no fix for this. I will keep you all updated.

    -Sheila

  • tiennoutiennou Member

    Hi everyone,

    Same error for me using RNAseq data. Looking forward for the fix and thanks for the help !

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @tiennou‌

    Hi,

    I just made a note that this should get a higher priority. Unfortunately, our department is undergoing a lot of change right now, so bugs are not getting fixed super rapidly. I will keep you all updated.

    -Sheila

  • jphekmanjphekman University of IllinoisMember

    I wanted to add my name to the list of people eagerly awaiting this fix! -Jessica

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @jphekman @tiennou @monicafabbro @skenoy @kisunpokharel‌

    Hi everyone,

    This bug is now fixed and will be available in tonight's nightly build. https://www.broadinstitute.org/gatk/nightly

    -Sheila

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @jphekman‌ @tiennou @monicafabbro‌ @skenoy @kisunpokharel‌

    Hi everyone,

    I am sorry I got a little too excited in my earlier post. There is a fix in place, but it needs to be approved before it is in the nightly.

    The fix will NOT be in tonight's nightly build. I will let you know when it is in the nightly. It should be in very soon.

    Thanks.

    -Sheila

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    All, the fix has been applied and will be available in the nightly builds starting tomorrow.

  • jphekmanjphekman University of IllinoisMember

    Just installed the nightly build and ran it -- SplitNCigarReads runs great, as does the next step in the pipeline with its output. Thanks so much for fixing this. Happy SNP calling everyone!

  • lenkahlenkah Czech RepublicMember

    Hi,
    I feel like great looser;-) I've tried the nighty builds from 17-01-2015 and 20-01-2015, but the error remains...

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @lenkah

    Hi,

    Can you please post your exact command and the stack trace with the error that you get from running the command?

    Thanks,
    Sheila

  • lenkahlenkah Czech RepublicMember
    edited February 2015

    @Sheila
    Hi, the command is
    java -Xmx5g -jar GenomeAnalysisTK.jar -T SplitNCigarReads -R hg19 -I dedupped.bam -o split.bam -rf ReassignOneMappingQuality -RMQF 255 -RMQT 60 -U ALLOW_N_CIGAR_READS
    It runs for a while and then there is an
    ERROR MESSAGE: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 45M354N2D326N5M
    Thanks a lot
    lenka

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @lenkah

    Hi Lenka,

    Can you upload your files as instructed here: http://gatkforums.broadinstitute.org/discussion/1894/how-do-i-submit-a-detailed-bug-report

    I don't think the fix should take too long, but I will let you know when it is fixed.

    Thanks,
    Sheila

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @lenkah

    Hi again Lenkah,

    Please ignore my previous comment. I made a mistake. You do not need to upload your files. You simply need to add -fixNDN to your command, and that will fix the issue.

    -Sheila

  • lenkahlenkah Czech RepublicMember

    @Sheila
    Sheila, thanks a lot!
    Now, it runs without errors;-)
    lenka

  • kornilipkornilip USAMember

    Hi I am having the same issue with the latest version of GATK. My command is:
    java -jar GenomeAnalysisTK.jar -T SplitNCigarReads -R genome.fa -I abc.dedup.bam -o abc.split.bam -rf ReassignOneMappingQuality -RMQF 255 -RMQT 60 -U ALLOW_N_CIGAR_READS -fixNDN --defaultBaseQualities 0
    The error is:

    ERROR A USER ERROR has occurred (version 3.4-46-gbc02625):
    ERROR
    ERROR This means that one or more arguments or inputs in your command are incorrect.
    ERROR The error message below tells you what is the problem.
    ERROR
    ERROR If the problem is an invalid argument, please check the online documentation guide
    ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
    ERROR
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions http://www.broadinstitute.org/gatk
    ERROR
    ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
    ERROR
    ERROR MESSAGE: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 69M274982N5D24055N19M

    The same result with the latest nightly-2015-09-02-g83dee1a version.
    Can anybody help me out?
    Thanks very much!
    Pavel

  • morgane5151morgane5151 zurichMember

    Hello
    I have the same problem with my bam file, tried with the nighlty build version from today and it didn't work either
    Following command:
    java -jar /gdc_home4/morgane/GenomeAnalysisTK.jar \
    -T SplitNCigarReads \
    -R /gdc_home4/morgane/Ref_withplastic_2014/ITAG2.4_ALL.fa \
    -I add_RG_sorted.bam \
    -o SplitNCigarReads_nightly.bam \
    -U ALLOW_N_CIGAR_READS

    **Error **
    INFO 11:34:14,447 GATKRunReport - Uploaded run statistics report to AWS S3

    ERROR ------------------------------------------------------------------------------------------
    ERROR A USER ERROR has occurred (version nightly-2015-09-03-g83dee1a):
    ERROR
    ERROR This means that one or more arguments or inputs in your command are incorrect.
    ERROR The error message below tells you what is the problem.
    ERROR
    ERROR If the problem is an invalid argument, please check the online documentation guide
    ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
    ERROR
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions http://www.broadinstitute.org/gatk
    ERROR
    ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
    ERROR
    ERROR MESSAGE: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 116M1045N3D282N8M

    Is there a way to skip such reads from the analysis or should I submit it for a debug?
    What if all my files have this problem? (I have 36 alignments)
    Thanks a lot for your precious help.
    Morgane

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @kornilip
    Hi Pavel,

    Can you tell me how you processed your samples before this step? Did you foloow our Best Practices?

    -Sheila

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @morgane5151
    Hi Morgane,

    Try adding -fixNDN to your command.

    Thanks,
    Sheila

  • kornilipkornilip USAMember

    Hi Sheila,
    I followed your Best Practice guideline except alignment step as I received bam files from the third party. I did:
    1. reorder BAM
    java -jar ReorderSam.jar INPUT=abc.bam OUTPUT=abc.reOrd.bam REFERENCE=genome.fa
    2. add group information
    java -jar AddOrReplaceReadGroups.jar I=abc.reOrd.bam O=abc.grAdd.bam LB=bogus_LB PL=illumina PU=bogus_PU SM=bogus_SM
    3. mark duplicates
    java -jar MarkDuplicates.jar I=abc.grAdd.bam O=abc.dedup.bam CREATE_INDEX=true VALIDATION_STRINGENCY=SILENT M=abc.output.metrics
    4. Split'N'Trim and reassign mapping quality
    java -jar GenomeAnalysisTK.jar -T SplitNCigarReads -R genome.fa -I abc.dedup.bam -o abc.split.bam -rf ReassignOneMappingQuality -RMQF 255 -RMQT 60 -U ALLOW_N_CIGAR
    _READS --defaultBaseQualities 0 -fixNDN
    And that is the step when my sequence fails.
    Thanks,
    Pavel

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @kornilip
    Hi Pavel,

    Hmm. This is odd. Can you submit a bug report? Instructions are here: http://gatkforums.broadinstitute.org/discussion/1894/how-do-i-submit-a-detailed-bug-report

    Thanks,
    Sheila

  • kornilipkornilip USAMember

    Hi Sheila.
    Thanks very much! I will do that.

  • kornilipkornilip USAMember

    Hi Sheila,
    Before submitting the report I installed the latest version of Picard tools and went through all steps again. Then I ran Picard ValidateSamFile. It me the failed but gave the following error: 'Exception in thread "main" htsjdk.samtools.SAMException: Value was put into PairInfoMap more than once. -1: HWI-ST534:220:D0B6AACXX:2:2305:15854:115438'
    I grep my bam file for this record and found two records with the same ID:
    "HWI-ST534:220:D0B6AACXX:2:2305:15854:115438 1161 chr1 1247736 50 1M521N72M85N15M * 0 0 CCAGCTGCATGATGCCCTTGGCGTCCGCGTGTGCGCTGAATGACATGTACTCCACCTGCATCTTGACCTCCAGCACCTGCCGCCCCTC HJGFAEGCHIHEHIIJIGGI[email protected];@FFHIGEEEDD?CCCCECC>;;;ACDDC<[email protected]@>;>ACDCCA<A?9A<C328B7&99AB MD:Z:88 PG:Z:MarkDuplicates RG:Z:group1 XG:i:0 NH:i:1 NM:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 XS:A:- YT:Z:UU"
    and
    "HWI-ST534:220:D0B6AACXX:2:2305:15854:115438 1113 chr1 1248246 50 84M85N4M * 0 0 TGCCTGGCCCACCAGCTGCATGATGCCCTTGGCGTCCGCGTGTGCGCTGTATGACATGTACTCCACCTGCATCTTGACCTCCAGCACC [email protected]<8?8?0(<3CCC>:>@ACC?92<<@>;;[email protected]::,([email protected]@[email protected]@GIIIHF MD:Z:49A38 PG:Z:MarkDuplicates RG:Z:group1 XG:i:0 NH:i:1 NM:i:1 XM:i:1 XN:i:0 XO:i:0 AS:i:0 XS:A:- YT:Z:UU"
    I guess that was the reason for the problem?

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @kornilip
    Hi Pavel,

    So, when you remove one of those offending reads, do you still get the SplitNCigarReads error?

    If not, that was the issue! Thanks for validating your file before submitting a bug report. :smile:

    -Sheila

  • kornilipkornilip USAMember

    Hi Sheila,
    I renamed duplicate read ids. After that I still got the same error from SplitNCigarReads:

    ERROR MESSAGE: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 23M1D10986N7D112N2D65M

    But, this time when I ran ValidateSamFile I got multiple errors like:
    ERROR: Read name HWI-ST534:220:D0B6AACXX:5:2202:8348:118870.dup, Mate not found for paired read
    ERROR: Read name HWI-ST534:220:D0B6AACXX:5:2307:4999:149446, Mate not found for paired read
    So I guess there were just paired reads that had the same IDs.
    Now I am not sure what to do next. I will try to narrow down the original problem for the report.
    Thanks,
    Pavel

  • _dongye_dongye ChinaMember

    INFO 07:15:23,004 ProgressMeter - Chr09:33531877 4496806.0 5.0 m 66.0 s 43.3% 11.6 m 6.6 m
    INFO 07:15:53,007 ProgressMeter - Chr10:37511272 4799610.0 5.5 m 69.0 s 48.8% 11.3 m 5.8 m
    INFO 07:16:07,728 GATKRunReport - Uploaded run statistics report to AWS S3

    ERROR ------------------------------------------------------------------------------------------
    ERROR A USER ERROR has occurred (version 3.5-0-g36282e4):
    ERROR
    ERROR This means that one or more arguments or inputs in your command are incorrect.
    ERROR The error message below tells you what is the problem.
    ERROR
    ERROR If the problem is an invalid argument, please check the online documentation guide
    ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
    ERROR
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions http://www.broadinstitute.org/gatk
    ERROR
    ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
    ERROR
    ERROR MESSAGE: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 31M407N1D1033N19M

    I encountered the same error with you, we even more amazing is wrong in the same position,which unit are you in ?
    I am using version 3.5 solved the problem with -fixNDN parameters

  • l0o0l0o0 beijingMember

    @_dongye said:
    INFO 07:15:23,004 ProgressMeter - Chr09:33531877 4496806.0 5.0 m 66.0 s 43.3% 11.6 m 6.6 m
    INFO 07:15:53,007 ProgressMeter - Chr10:37511272 4799610.0 5.5 m 69.0 s 48.8% 11.3 m 5.8 m
    INFO 07:16:07,728 GATKRunReport - Uploaded run statistics report to AWS S3

    ERROR ------------------------------------------------------------------------------------------
    ERROR A USER ERROR has occurred (version 3.5-0-g36282e4):
    ERROR
    ERROR This means that one or more arguments or inputs in your command are incorrect.
    ERROR The error message below tells you what is the problem.
    ERROR
    ERROR If the problem is an invalid argument, please check the online documentation guide
    ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
    ERROR
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions http://www.broadinstitute.org/gatk
    ERROR
    ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
    ERROR
    ERROR MESSAGE: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 31M407N1D1033N19M

    I encountered the same error with you, we even more amazing is wrong in the same position,which unit are you in ?
    I am using version 3.5 solved the problem with -fixNDN parameters

    This parameter really help me.

  • JuttaJutta Bonn, GermanyMember

    Hi,
    I am following the RNA-seq Best Practice pipeline. However for one of my samples I also obtained this Error Message: Bad input: Cannot split this read (might be an empty section between Ns, for example 1N1D1N): 10M53N2D99N90M

    When I included -fixNDN in my code it seems to work fine:

    java -jar /media/storage/Serverdaten/GATK-SNP_calling/GenomeAnalysisTK.jar -T SplitNCigarReads
    -R Zea_mays.AGPv3.31.dna.genome.edit.fa
    -I A554-I-1_reordered.bam
    -o A554-I-1_SplitNCigar.bam
    -rf ReassignOneMappingQuality
    -RMQF 255
    -RMQT 60
    -U ALLOW_N_CIGAR_READS
    -fixNDN

    Now, I was wondering if I also should include -fixNDN also for my other samples, for which the program code worked fine without the -fixNDN statement?

    Thanks for your advices,
    Jutta

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin
    Hi Jutra, if the others worked fine there is no need to reprocess them with that flag.
  • JuttaJutta Bonn, GermanyMember

    Hi,

    When continuing running SplitNCigarReads for my other samples, I get different error messages. However, when I re-run those samples, which were aborded, twice or three-times again, everything works quite well. Running SplitNCigarReads for one samples takes usually around one hour and in total I have 180, so I can't re-run several samples more than once. Is there solution how to fix this problem?
    I used the same code for every sample, except of -fixNDN, which I posted above.

    Here are the error messages I get:

    A fatal error has been detected by the Java Runtime Environment:
    SIGSEGV (0xb) at pc=0x00007f70de54e013, pid=30397, tid=0x00007f70dc258700
    JRE version: Java(TM) SE Runtime Environment (8.0_111-b14) (build 1.8.0_111-b14)
    Java VM: Java HotSpot(TM) 64-Bit Server VM (25.111-b14 mixed mode linux-amd64 compressed oops)
    Problematic frame:
    V [libjvm.so+0x98d013] oopDesc* PSPromotionManager::copy_to_survivor_space(oopDesc*)+0x143
    Failed to write core dump. Core dumps have been disabled. To enable core dumping, try "ulimit -c unlimited" before starting Java again
    An error report file with more information is saved as:
    /media/storage/Serverdaten/GATK-SNP_calling/SplitNTrim/hs_err_pid30397.log
    If you would like to submit a bug report, please visit:
    http://bugreport.java.com/bugreport/crash.jsp

    Here, tried "ulimit -c unlimited" as suggested, but still I get these error messages or another one of the following for the same sample.

    ERROR stack trace

    java.lang.IllegalArgumentException: Bad byte passed to charToCompressedBase: 1
    at htsjdk.samtools.SAMUtils.charToCompressedBaseHigh(SAMUtils.java:274)
    at htsjdk.samtools.SAMUtils.bytesToCompressedBases(SAMUtils.java:118)
    at htsjdk.samtools.BAMRecordCodec.encode(BAMRecordCodec.java:153)
    at htsjdk.samtools.BAMRecordCodec.encode(BAMRecordCodec.java:37)
    at htsjdk.samtools.util.SortingCollection.spillToDisk(SortingCollection.java:226)
    at htsjdk.samtools.util.SortingCollection.add(SortingCollection.java:166)
    at htsjdk.samtools.SAMFileWriterImpl.addAlignment(SAMFileWriterImpl.java:192)
    ...

    ERROR ------------------------------------------------------------------------------------------
    ERROR A GATK RUNTIME ERROR has occurred (version 3.6-0-g89b7209):
    ERROR
    ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
    ERROR If not, please post the error message, with stack trace, to the GATK forum.
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions https://www.broadinstitute.org/gatk
    ERROR
    ERROR MESSAGE: Bad byte passed to charToCompressedBase: 1

    OR:

    ...

    ERROR ------------------------------------------------------------------------------------------
    ERROR A GATK RUNTIME ERROR has occurred (version 3.6-0-g89b7209):
    ERROR
    ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
    ERROR If not, please post the error message, with stack trace, to the GATK forum.
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions https://www.broadinstitute.org/gatk
    ERROR
    ERROR MESSAGE: Code exception (see stack trace for error itself)

    Sorry, for the long post. I am no computer/Linux-Pro and hope to get once again any help or suggestions.
    Thank you very much!
    Jutta

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Hi Jutta, this looks like your computer system is unstable and is crashing semi-randomly. I don't think it's a GATK-specific problem. I would recommend getting help from whoever supports your IT infrastructure.

  • kim_1kim_1 Member

    Hi, I have recently met with the same problem (ERROR A GATK RUNTIME ERROR has occurred (version 3.2-2-gec30cee) ) by using the past version of gatk in SNP analysis of RNA products. I cannot use the nightly built version due to other issues with my workflow. So if I continue to use the old version, can I just remove the SplitNCigarReads step? When I have removed that step between MarkDuplicates and BaseRecalibrator, there is still no result. Could you please help me to figure out why is it? Thank you.

  • bhanuGandhambhanuGandham Member, Administrator, Broadie, Moderator admin

    Hi @kim_1

    Would you please send me the exact commands you are running, the version of gatk and the entire error log please.

    Thank you

  • bhanuGandhambhanuGandham Member, Administrator, Broadie, Moderator admin

    Hi @kim_1

    We have not heard from you in 2 business days and hence will be closing this issue now.

    Regards
    Bhanu

  • kim_1kim_1 Member
    Hi @bhanuGandham ,
    Sorry I did not noticed your reply, thank you very much and I still got the problem and need you help.
    The version I used is V 3.8

    My code is:
    ReorderSam = "{picard}/ReorderSam.jar I={bam} O=%s.reorder.bam R={ref} TMP_DIR=%s.tmp && \\" % (smp,smp)
    SortSam = "{picard}/SortSam.jar I=%s.reorder.bam O=%s.reorder.sort.bam SO=coordinate TMP_DIR=%s.tmp && \\" % ((smp,)*3)
    RemoveReorderbam = "rm -rf %s.reorder.bam" % (smp)
    AddOrReplaceReadGroups = "{picard}/AddOrReplaceReadGroups.jar I=%s.reorder.sort.bam O=%s.reorder.sort.head.bam LB=LB PL=ILLUMINA PU=PU SM={sample} TMP_DIR=%s.tmp && \\" % ((smp,)*3)
    RemoveSortsam = "rm -rf %s.reorder.sort.bam" % (smp)
    MarkDuplicates = "{picard}/MarkDuplicates.jar I=%s.reorder.sort.head.bam O=%s.reorder.sort.head.dedup.bam M=%s.reorder.sort.head.dedup.metrics VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true REMOVE_DUPLICATES=true MAX_FILE_HANDLES_FOR_READ_ENDS_MAP=250 TMP_DIR=%s.tmp && \\" % ((smp,)*4)
    Removeheadbam = "rm -rf %s.reorder.sort.head.bam" % (smp)
    BaseRecalibrator = "{software} -T BaseRecalibrator -R {ref} -I %s.reorder.sort.head.dedup.bam -o %s.reorder.sort.head.dedup.recal.grp {knownSites} -knownSites {dbsnp} && \\" %(smp,smp)
    PrintReads = "{software} -T PrintReads -R {ref} -I %s.reorder.sort.head.dedup.bam -o %s.reorder.sort.head.dedup.recal.bam -BQSR %s.reorder.sort.head.dedup.recal.grp && \\" % ((smp,)*3)
    Removedupbam = "rm -rf %s.reorder.sort.head.dedup.bam %s.reorder.sort.head.dedup.bai %s.reorder.sort.head.dedup.metrics" % (smp,smp,smp)
    Snp_bam = "mv %s.reorder.sort.head.dedup%s.bam %s.snp.bam" % (smp, self.is_known and ".recal" or "", smp)
    Snp_bai = "mv %s.reorder.sort.head.dedup%s.bai %s.snp.bai" % (smp, self.is_known and ".recal" or "", smp)
    Removerecalgrp = "rm -rf %s.reorder.sort.head.dedup.recal.grp" % (smp)
    Endbam = "echo 'Bam preparation End: ' `date`"
    if self.is_known:
    shell = "\n\n".join((Startbam, ReorderSam, SortSam, RemoveReorderbam, AddOrReplaceReadGroups, RemoveSortsam,
    MarkDuplicates, Removeheadbam, BaseRecalibrator, PrintReads, Removedupbam,Snp_bam, Snp_bai, Removerecalgrp, Endbam
    ))
    else:
    shell = "\n\n".join((Startbam, ReorderSam, SortSam, RemoveReorderbam, AddOrReplaceReadGroups, RemoveSortsam, MarkDuplicates, Removeheadbam, Snp_bam, Snp_bai, Endbam))
    snpbam = []
    after = self.fq and ('snp_'+sample+'_Mapping', 'snp_makedict') or 'snp_makedict'


    The Error message is:
    INFO 11:09:23,625 ReadShardBalancer$1 - Done loading BAM index data
    ##### ERROR ------------------------------------------------------------------------------------------
    ##### ERROR A USER ERROR has occurred (version 3.8-0-ge9d806836):
    ##### ERROR
    ##### ERROR This means that one or more arguments or inputs in your command are incorrect.
    ##### ERROR The error message below tells you what is the problem.
    ##### ERROR
    ##### ERROR If the problem is an invalid argument, please check the online documentation guide
    ##### ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
    ##### ERROR
    ##### ERROR Visit our website and forum for extensive documentation and answers to
    ##### ERROR commonly asked questions
    ##### ERROR
    ##### ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
    ##### ERROR
    ##### ERROR MESSAGE: Unsupported CIGAR operator N in read A00197:75:HH52WDMXX:2:1383:32027:5603 at chr1:14716. If you are working with RNA-Seq data, see
    ##### ERROR ------------------------------------------------------------------------------------------


    Could you please help me to find out the issue? Thank you very much!
  • bhanuGandhambhanuGandham Member, Administrator, Broadie, Moderator admin

    HI @kim_1

    We're aware that SplitNCigarReads causes some invalid read issues; this was a bug but this has been addressed in the GATK4. You will need to use the latest version in gatk4 to overcome this issue.
    I hope this helps.

    Regards
    Bhanu

  • kim_1kim_1 Member
    edited December 7
    HI @bhanuGandham ,
    Thank you for replying, but I can not change the version due to some issue with my workflow, I have already removed the SplitNCigarReads step in my code, I think th error occurs at the BaseRecalibrator step, could you please help me figure out whether my code is alright? Thank you.

    My code is:
    ReorderSam = "{picard}/ReorderSam.jar I={bam} O=%s.reorder.bam R={ref} TMP_DIR=%s.tmp && \\" % (smp,smp)
    SortSam = "{picard}/SortSam.jar I=%s.reorder.bam O=%s.reorder.sort.bam SO=coordinate TMP_DIR=%s.tmp && \\" % ((smp,)*3)
    RemoveReorderbam = "rm -rf %s.reorder.bam" % (smp)
    AddOrReplaceReadGroups = "{picard}/AddOrReplaceReadGroups.jar I=%s.reorder.sort.bam O=%s.reorder.sort.head.bam LB=LB PL=ILLUMINA PU=PU SM={sample} TMP_DIR=%s.tmp && \\" % ((smp,)*3)
    RemoveSortsam = "rm -rf %s.reorder.sort.bam" % (smp)
    MarkDuplicates = "{picard}/MarkDuplicates.jar I=%s.reorder.sort.head.bam O=%s.reorder.sort.head.dedup.bam M=%s.reorder.sort.head.dedup.metrics VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true REMOVE_DUPLICATES=true MAX_FILE_HANDLES_FOR_READ_ENDS_MAP=250 TMP_DIR=%s.tmp && \\" % ((smp,)*4)
    Removeheadbam = "rm -rf %s.reorder.sort.head.bam" % (smp)
    BaseRecalibrator = "{software} -T BaseRecalibrator -R {ref} -I %s.reorder.sort.head.dedup.bam -o %s.reorder.sort.head.dedup.recal.grp {knownSites} -knownSites {dbsnp} && \\" %(smp,smp)
    PrintReads = "{software} -T PrintReads -R {ref} -I %s.reorder.sort.head.dedup.bam -o %s.reorder.sort.head.dedup.recal.bam -BQSR %s.reorder.sort.head.dedup.recal.grp && \\" % ((smp,)*3)
    Removedupbam = "rm -rf %s.reorder.sort.head.dedup.bam %s.reorder.sort.head.dedup.bai %s.reorder.sort.head.dedup.metrics" % (smp,smp,smp)
    Snp_bam = "mv %s.reorder.sort.head.dedup%s.bam %s.snp.bam" % (smp, self.is_known and ".recal" or "", smp)
    Snp_bai = "mv %s.reorder.sort.head.dedup%s.bai %s.snp.bai" % (smp, self.is_known and ".recal" or "", smp)
    Removerecalgrp = "rm -rf %s.reorder.sort.head.dedup.recal.grp" % (smp)
    Endbam = "echo 'Bam preparation End: ' `date`"
    if self.is_known:
    shell = "\n\n".join((Startbam, ReorderSam, SortSam, RemoveReorderbam, AddOrReplaceReadGroups, RemoveSortsam,
    MarkDuplicates, Removeheadbam, BaseRecalibrator, PrintReads, Removedupbam,Snp_bam, Snp_bai, Removerecalgrp, Endbam
    ))
    else:
    shell = "\n\n".join((Startbam, ReorderSam, SortSam, RemoveReorderbam, AddOrReplaceReadGroups, RemoveSortsam, MarkDuplicates, Removeheadbam, Snp_bam, Snp_bai, Endbam))
    snpbam = []
    after = self.fq and ('snp_'+sample+'_Mapping', 'snp_makedict') or 'snp_makedict'







    The Error message is :
    INFO 11:09:23,620 BaseRecalibrator - CycleCovariate
    INFO 11:09:23,624 ReadShardBalancer$1 - Loading BAM index data
    INFO 11:09:23,625 ReadShardBalancer$1 - Done loading BAM index data
    ##### ERROR ------------------------------------------------------------------------------------------
    ##### ERROR A USER ERROR has occurred (version 3.8-0-ge9d806836):
    ##### ERROR
    ##### ERROR This means that one or more arguments or inputs in your command are incorrect.
    ##### ERROR The error message below tells you what is the problem.
    ##### ERROR
    ##### ERROR If the problem is an invalid argument, please check the online documentation guide
    ##### ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
    ##### ERROR
    ##### ERROR Visit our website and forum for extensive documentation and answers to
    ##### ERROR commonly asked questions
    ##### ERROR
    ##### ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
    ##### ERROR
    ##### ERROR MESSAGE: Unsupported CIGAR operator N in read A00197:75:HH52WDMXX:2:1383:32027:5603 at chr1:14716. I
    ##### ERROR ---------------------------------------------------
    Post edited by kim_1 on
  • bhanuGandhambhanuGandham Member, Administrator, Broadie, Moderator admin

    HI @kim_1

    Another user had a similar issue, please refer to this thread for the suggested solution:https://gatkforums.broadinstitute.org/gatk/discussion/12553/calling-variants-in-rnaseq-stuck-at-step-5-please-help

    Looks like you will need to run SplitNCigarReads as mentioned in the thread. Try this out and let me know if it works for you. If it doesn't please post the command you are using for SplitNCigarReads.

    Regards
    Bhanu

Sign In or Register to comment.