Writting a SlidingWindow RodWalker

Is there anyway to write a sliding window RodWalker? I've been try to look in your documentation, but I have not found a clue.

Best Answer

Answers

  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Our developer documentation is woefully inadequate at the moment, sorry. We're hoping to improve it in the near future. In the meantime, I can only point you at existing walkers as examples. But I'm not sure what you mean by sliding window rod walker -- could you briefly outline what you want the walker to do?

  • andremrsantosandremrsantos Member
    edited February 2014

    I want the RodWalker to evaluate a region (window) per time moving forward some steps per time.

    SEQUENCE: ATACAGCATGCAGGCAGCAGCAGCAGCAGCAGTGCACAGACT 
    VARIANT:     *    *       *        *       *   *   *
    1st      [--------------------]
    2nd               [--------------------] 
    ...
    last                          [--------------------]
    

    Something like that

  • andremrsantosandremrsantos Member
    edited February 2014

    Sorry, I have some format issue

    SEQUENCE: ATACAGCATGCAGGCAGCAGCAGCAGCAGCAGTGCACAGACT 
    VARIANT:      *     *    *    *  *  *       *    *        *     *      *
    1st               [--------------------]  
    2nd                             [--------------------]   
    ...   
    last                                                                    [--------------------]  
    
  • Geraldine_VdAuweraGeraldine_VdAuwera Cambridge, MAMember, Administrator, Broadie admin

    Then I'm not sure a RodWalker is the right template to use. RodWalkers, as their name indicates, walk along the records in a ROD file. It sounds like what you need is a LocusWalker that will walk along the reference and retrieve context information from the ROD where available (using MetaDataTracker). This is like how UnifiedGenotyper retrieves data from a dbsnp file to annotate the rsID field in variant records. Depending on exactly what operations you need to do, you could collect data per locus then aggregate it per window of interest.

  • Could you give an example? When I try to change my walker to Locus return error

  • magicDGSmagicDGS Member

    Hello, I also need to implement tools in sliding window (size and step provided by the user) and I don't know how could I do it. Is it now possible to implement it easily?

    Thank you in advance.

Sign In or Register to comment.