ERROR MESSAGE: Start cannot exceed end.

chris2013chris2013 chinaMember

Hi support team. I meet an error when I am running the GenomesSTRiP. The error message is at below.

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

java.lang.IllegalArgumentException: Start cannot exceed end.
at net.sf.picard.util.IntervalTree.put(IntervalTree.java:71)
at org.broadinstitute.sv.util.IntervalTreeMap.put(IntervalTreeMap.java:112)
at org.broadinstitute.sv.discovery.ReadPairClusteringAlgorithm.addToClusterIndex(ReadPairClusteringAlgorithm.java:464)
at org.broadinstitute.sv.discovery.ReadPairClusteringAlgorithm.processReadPair(ReadPairClusteringAlgorithm.java:323)
at org.broadinstitute.sv.discovery.ReadPairClusteringAlgorithm.computeClusterBounds(ReadPairClusteringAlgorithm.java:256)
at org.broadinstitute.sv.discovery.ReadPairClusteringAlgorithm.access$100(ReadPairClusteringAlgorithm.java:46)
at org.broadinstitute.sv.discovery.ReadPairClusteringAlgorithm$ClusterIterator.(ReadPairClusteringAlgorithm.java:1070)
at org.broadinstitute.sv.discovery.ReadPairClusteringAlgorithm.clusterReadPairs(ReadPairClusteringAlgorithm.java:207)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processClusters(DeletionDiscoveryAlgorithm.java:333)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runDiscovery(DeletionDiscoveryAlgorithm.java:187)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:110)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVDiscoveryWalker.java:43)
at org.broadinstitute.sting.gatk.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:123)
at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:286)
at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113)
at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:125)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:79)
at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.5-2-g5671483):
ERROR
ERROR Please check the documentation guide to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Start cannot exceed end.
ERROR ------------------------------------------------------------------------------------------

It seems that this error will occurs on the boundary region of a chromosome. In my experiment, it occurs on chr6:160000001-171115067, chr6:140000001-160000000, chr5:1-20000000, chr16:1-20000000.
One of my scripts is at below.
GenomeAnalysisTK.jar:Queue.jar org.broadinstitute.sv.main.SVDiscovery -T SVDiscoveryWalker -R hg19.fa -I list -O P0129.discovery.vcf -disableGATKTraversal true -md metadata -configFile genstrip_parameters.txt -runDirectory work -genderMapFile gender.list -genomeMaskFile hg19.101.mask.real.fasta -partitionName P0129 -runFilePrefix P0129 -L chr16:1-21010001 -searchLocus chr16:1-20000000 -searchWindow chr16:1-21010001 -searchMinimumSize 50 -searchMaximumSize 1000000

Any information would be greatly appreciated! Thank you very much.

Best Answer

Answers

  • chris2013chris2013 chinaMember

    Using the b37 reference, this error is fixed.

  • chris2013chris2013 chinaMember

    @chris2013 said:
    Using the b37 reference, this error is fixed.

    I think it may not be the true reason.
    The true reason is that some strange alignment in the BAM files.
    These strange alignments seems to be generated by the GATK realigner.

    B81ECYABXX:4:2202:17795:32483#0 99 chr5 6313853 39 100I = 6314026 268 CCCACATCCTCTGATGCTCCCTCCTGGGGGCCCCACATCCTCTGATGCTCCCTCCTGGGGGCCCCACATCATTTGTCCTCCCTCTTGGGTGCTCCCACAT FFFFFFFFFFFFEFEFFFFFFEFFFFFDFFFEFBFFEBFEFFFFBDFBFF;>+A>@EB9<;[email protected]@ECEF;9CC4>[email protected]################ X0:i:1 X1:i:0 OC:Z:24M31D76M RG:Z:FC81ECYABXX_L4 XG:i:31 AM:i:29 NM:i:100 SM:i:29 XM:i:0 XO:i:1 MQ:i:29 OQ:Z:HHHHHHHHHHHHEGEGGHHHHEHHHHHCHHHEHBHHEBHDGFFFBCFBFF8=*>=?EB7:FFEB>CC?CD?EAEF97AA2=3/?################ XT:A:U

    The CIGAR is 100I. This makes the start position > end position.
    A new version of GenomeSTRiP is coming to fix this.

Sign In or Register to comment.