We've moved!
This site is now read-only. You can find our new documentation site and support forum for posting questions here.
Be sure to read our welcome blog!

Insertion interpretation

brdidobrdido São Paulo - BrazilMember

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

Best Answer

Answers

Sign In or Register to comment.