The current GATK version is 3.7-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Get notifications!

You can opt in to receive email notifications, for example when your questions get answered or when there are new announcements, by following the instructions given here.

Got a problem?

1. Search using the upper-right search box, e.g. using the error message.
2. Try the latest version of tools.
3. Include tool and Java versions.
4. Tell us whether you are following GATK Best Practices.
5. Include relevant details, e.g. platform, DNA- or RNA-Seq, WES (+capture kit) or WGS (PCR-free or PCR+), paired- or single-end, read length, expected average coverage, somatic data, etc.
6. For tool errors, include the error stacktrace as well as the exact command.
7. For format issues, include the result of running ValidateSamFile for BAMs or ValidateVariants for VCFs.
8. For weird results, include an illustrative example, e.g. attach IGV screenshots according to Article#5484.
9. For a seeming variant that is uncalled, include results of following Article#1235.

Did we ask for a bug report?

Then follow instructions in Article#1894.

Formatting tip!

Wrap blocks of code, error messages and BAM/VCF snippets--especially content with hashes (#)--with lines with three backticks ( ``` ) each to make a code block as demonstrated here.

Jump to another community
Picard 2.10.2 is now available at
GATK version 4.beta.2 (i.e. the second beta release) is out. See the GATK4 BETA page for download and details.

Insertion interpretation

brdidobrdido São Paulo - BrazilMember

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

1948 x 1023 - 90K

Best Answer


Sign In or Register to comment.