Forum Login Issue:
Currently the "Log in with Google" button redirects you to a "Page not found." This is an issue that our forum vendors are working on fixing. In the meantime, while on the "Page not found" you can edit the URL to delete the second gatk, firecloud, or wdl (depending on what subforum you are acessing).
ex: https://gatkforums.broadinstitute.org/gatk/gatk/entry/...

Insertion interpretation

brdidobrdido São Paulo - BrazilMember

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

Best Answer

Answers

Sign In or Register to comment.