Service notice: Several of our team members are on vacation so service will be slow through at least July 13th, possibly longer depending on how much backlog accumulates during that time. This means that for a while it may take us more time than usual to answer your questions. Thank you for your patience.

Insertion interpretation

brdidobrdido São Paulo - BrazilMember

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

Best Answer

Answers

Sign In or Register to comment.