Test-drive the GATK tools and Best Practices pipelines on Terra

Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Insertion interpretation

brdidobrdido São Paulo - BrazilMember

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

Best Answer


Sign In or Register to comment.