Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Indelocator "Invalid record length"

Hi all,

thanks for sharing Indelocator with the community. Unfortunately I get an error message:

java -jar /users/GD/tools/GATK/GenomeAnalysisTK-2.6-4-g3e5ff60/IndelGenotyper.36.3336-GenomeAnalysisTK.jar -T IndelGenotyperV2 --somatic -I:normal ~/ND.realigned.dm.recalibrated.bam -I:tumor ~/TD.realigned.dm.recalibrated.bam --out somatic.indels --metrics_file somatic.metrics --bedOutput somatic.bed --reference_sequence ~/hg19.fasta


INFO 21:17:12,957 HelpFormatter - The Genome Analysis Toolkit (GATK) v1.0.4905, Compiled 2010/12/23 10:17:26
INFO 21:17:12,957 HelpFormatter - Copyright (c) 2010 The Broad Institute
INFO 21:17:12,958 HelpFormatter - Please view our documentation at http://www.broadinstitute.org/gsa/wiki
INFO 21:17:12,958 HelpFormatter - For support, please view our support site at http://getsatisfaction.com/gsa
INFO 21:17:12,958 HelpFormatter - Program Args: -T IndelGenotyperV2 --somatic -I:normal ~/ND.realigned.dm.recalibrated.bam -I:tumor ~/TD.realigned.dm.recalibrated.bam --out somatic.indels --metrics_file somatic.metrics --bedOutput somatic.bed --reference_sequence ~/hg19.fasta
INFO 21:17:12,959 HelpFormatter - Date/Time: 2013/07/05 21:17:12


INFO 21:17:12,988 GenomeAnalysisEngine - Strictness is SILENT
INFO 21:17:13,866 GATKRunReport - Aggregating data for run report

ERROR stack trace

net.sf.samtools.SAMFormatException: Invalid record length: 1178186
at net.sf.samtools.BAMRecordCodec.decode(BAMRecordCodec.java:167)
...

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 1.0.4905):
ERROR
ERROR Please visit to wiki to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki
ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa
ERROR
ERROR MESSAGE: Invalid record length: 1178186
ERROR ------------------------------------------------------------------------------------------`

So i guessed that some reads might be too far away from each other in one of the bam files and I do see the following:

samtools view ~/TD.realigned.dm.recalibrated.bam | grep 1178186
HWI-ST537_95:7:2108:1480:46165#[email protected] 99 1 1178118 180 76M = 1178186 144 GAGGCCCCAGAGGTCTGCGCCCTGAGGGCACCGAGCTCACACCCGGCCCAGCCCGAGTGCACCCGAGCCCTCCCGC >?=>??;?=?>[email protected][email protected]>=>6?>?>;=$,=6,+*,>?=7=?>>=:=?9>.=?<28,;:9:.;<=776;99;;:96< BD:Z:JJKLMNKKLLKKLKKJKKIKLIKKKKKIKLIKHJKLLJLJJJLJIILMKLLMMJIJKLJKLIKJHJKLMKMMLJHL RG:Z:305TD BI:Z:FFDGHHHHHHEGJIIJJJHIJJJKJIKKKJJKKKIKLKKKKKLKKJLLKKKJJHGFDEDDCCCCCCBDEEFFGFFF NM:i:5 MQ:i:180 XT:A:U md:Z:26T49
HWI-ST537_95:7:2108:1480:46165#[email protected] 147 1 1178186 180 76M = 1178118 -144 CCTCCCGCCCCCCCCCGGCCCGGACTCACCTGCAGCTGCAGCAGCCCCTGCACCTGTAGCGTGAAGACCCTGCTGG #############[email protected]=78?>2:?=6=:47;??>>=<65<;<??>7.710>;,;08;9=:>9:80<<<:<<:4- BD:Z:JJJJMLKKKJJJJIHHLKIIHLLLLLKLLLLLLLLLLLLLLLLKIIKKKKJJKKIJJKJHHJIIJJJIKLLMLLJJ RG:Z:305TD BI:Z:FFFFFEDDDCCBBCBCDEFEFHIJHKKKLKKLLLKKKLLKLLKKKKKJJJJJJIHIGIHHGGHHHGGGGFEFFFFF NM:i:5 MQ:i:180 XT:A:U md:Z:A62T1T1A8</code>

The bam files are not created by BWA so maybe GATK doesn't encounter those distances too often.
What would be the longest distance between reads allowed?

regards,
Oliver

Sign In or Register to comment.