We've moved!
This site is now read-only. You can find our new documentation site and support forum for posting questions here.
Be sure to read our welcome blog!

GATK3 MuTect2 AF calculation

jmoajmoa koreaMember

Dear GATK developers.

I've run GATK3 MuTect2 with Tumor only mode and encountered following INDEL:
chr12 133218878 . C CAGCCAGAGCAGGTGGGGCCTCCTGTGCCCTCGGGAATCTGAAT . clustered_events;homologous_mapping_event ECNT=6;HCNT=7;MAX_ED=23;MIN_ED=7;TLOD=45.92 GT:AD:AF:ALT_F1R2:ALT_F2R1:FOXOG:QSS:REF_F1R2:REF_F2R1 0/1:653,0:0.043:0:0:.:19476,0:308:345

As you can see in the AD field, alt allele depth is zero. However, AF:0.043.
I'm aware that AD field only represent informative reads so AD can be zero.
I'm curious about two things:
1. How does MuTect2 call variants if there is no informative reads? Does it use all the reads(informative + uninformative) to call variants and just indicate only informative reads in AD field?
2. Is there a flag or metric in vcf which indicate the quality of variant due to uninformative reads?

Thank you.

Answers

Sign In or Register to comment.