The current GATK version is 3.8-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Get notifications!


You can opt in to receive email notifications, for example when your questions get answered or when there are new announcements, by following the instructions given here.

Got a problem?


1. Search using the upper-right search box, e.g. using the error message.
2. Try the latest version of tools.
3. Include tool and Java versions.
4. Tell us whether you are following GATK Best Practices.
5. Include relevant details, e.g. platform, DNA- or RNA-Seq, WES (+capture kit) or WGS (PCR-free or PCR+), paired- or single-end, read length, expected average coverage, somatic data, etc.
6. For tool errors, include the error stacktrace as well as the exact command.
7. For format issues, include the result of running ValidateSamFile for BAMs or ValidateVariants for VCFs.
8. For weird results, include an illustrative example, e.g. attach IGV screenshots according to Article#5484.
9. For a seeming variant that is uncalled, include results of following Article#1235.

Did we ask for a bug report?


Then follow instructions in Article#1894.

Formatting tip!


Wrap blocks of code, error messages and BAM/VCF snippets--especially content with hashes (#)--with lines with three backticks ( ``` ) each to make a code block as demonstrated here.

Jump to another community
Download the latest Picard release at https://github.com/broadinstitute/picard/releases.
GATK version 4.beta.3 (i.e. the third beta release) is out. See the GATK4 beta page for download and details.

start(0) > (-1) STOP

Hi all, I'm trying to perform BQRS on a bam file I have. Unfortunately I get this error:

##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
org.broadinstitute.sting.utils.exceptions.ReviewedStingException: START (0) > (-1) STOP -- this should never happen, please check read: HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 2/2 101b aligned read. (CIGAR: 5D74M27S)

The culprit appears to be this read pair:

HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 147 chr2    230419662   24  5D74M27S    =   230419667   -74 GAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGTGAAAGGAAGGGAAAAGAAAAAGGAAAGGAAGGCAATCCCTGCCCAGGTTCTTAATTTTC   #####A>:3CC>;=>DC@;>66;.3@DAA>CA@77.)((./))@FBB.<<??/9*0*******00*?1***1*1)1)<)B3++2+2+22++2222+4++B=   PG:Z:MarkDuplicates RG:Z:GB_L008.1  NM:i:9  AS:i:43 XS:i:45
HWI-ST1296:110:C1P16ACXX:8:2116:15747:68300 99  chr2    230419667   53  83M18S  =   230419662   74  GAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAAGGGAGAAAGGAAGGAAAAAGAGAAAGGGAAGGAAGGAAATTCATGCTCAGTATCTAATTTTTA   ??;ADDDDHBF3DA=GBGB@D;EFC<3CDHBHICDEGEGIE=@@A@D@;C;;2?@7;=7>>;5>;;@B1<@CB<?>>::4++>@@>CC44>>@DC(:CA##   PG:Z:MarkDuplicates RG:Z:GB_L008.1  NM:i:0  AS:i:83 XS:i:50

Program arguments were:

-R /lustre1/genomes/hg19/fa/hg19.fa -knownSites /lustre1/genomes/hg19/annotation/dbSNP-137.chr.vcf -I GB_dedup.realign.bam -T BaseRecalibrator --covariate QualityScoreCovariate --covariate CycleCovariate --covariate ContextCovariate --covariate ReadGroupCovariate --unsafe ALLOW_SEQ_DICT_INCOMPATIBILITY -nct 64 -o jobdir/GB.grp

I'm running the latest nightbuild of GATK.
Any hint is very much appreciated

d

Tagged:

Best Answer

Answers

Sign In or Register to comment.