Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.
Attention:
We will be out of the office on November 11th and 13th 2019, due to the U.S. holiday(Veteran's day) and due to a team event(Nov 13th). We will return to monitoring the GATK forum on November 12th and 14th respectively. Thank you for your patience.

HaplotypeCaller output modes EMIT_ALL_CONFIDENT_SITES and EMIT_ALL_SITES not working

davidmarquesdavidmarques Univesity of BernMember
Dear GATK-Team,

First of all, thank you for your great support and constant development of GATK! I was very pleased to see that the output mode options EMIT_ALL_CONFIDENT_SITES and EMIT_ALL_SITES were reintroduced recently in HaplotypeCaller (GitHub Issue 2865, I am not allowed to post links yet). However, I think these options or not yet working.

When I am using the --output-mode options EMIT_ALL_CONFIDENT_SITES and EMIT_ALL_SITES, only some seemingly random monomorphic sites are reported with site quality QUAL="Infinity", instead of all sites (monomorphic sites and variants). This, despite many, many high depth covered monomorphic sites in my dataset. I get the same buggy result for single-sample calling and for multi-sample calling with HaplotypeCaller. I am using GATK version v4.1.2.0, java 1.8.0_101-b13.

Here is the commands I used to get all confident sites for a two samples:
gatk --java-options "-Xmx10G -Xms1G" HaplotypeCaller --tmp-dir ./temp -R ref.fasta -I 22363.subset.bam -I 22365.subset.bam -L scaffold_7232:1-1000 -O test.allconf.vcf.gz --pcr-indel-model NONE --output-mode EMIT_ALL_CONFIDENT_SITES

The resulting VCF file look like this (barring all except the last header lines):
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 22363 22365
scaffold_7232 49 . C T 539.88 . AC=1;AF=0.250;AN=4;BaseQRankSum=-0.334;DP=132;ExcessHet=3.0103;FS=0.857;MLEAC=1;MLEAF=0.250;MQ=42.22;MQRankSum=-0.781;QD=5.57;ReadPosRankSum=-1.285;SOR=0.578 GT:AD:DP:GQ:PL 0/1:74,23:97:99:548,0,2548 0/0:33,0:33:99:0,99,1296
scaffold_7232 241 . A . Infinity . AN=4;DP=332;MQ=43.51 GT:AD:DP 0/0:232:232 0/0:100:100
scaffold_7232 276 . A C 1514.46 . AC=2;AF=0.500;AN=4;BaseQRankSum=2.611;DP=318;ExcessHet=4.7712;FS=2.430;MLEAC=2;MLEAF=0.500;MQ=42.98;MQRankSum=-0.010;QD=4.76;ReadPosRankSum=1.388;SOR=0.544 GT:AD:DP:GQ:PL 0/1:172,41:213:99:1039,0,5920 0/1:85,20:105:99:485,0,2913
scaffold_7232 333 . T . Infinity . AN=4;DP=311;MQ=41.99 GT:AD:DP 0/0:202:202 0/0:109:109
scaffold_7232 343 . C T 4427.46 . AC=2;AF=0.500;AN=4;BaseQRankSum=0.018;DP=319;ExcessHet=4.7712;FS=5.050;MLEAC=2;MLEAF=0.500;MQ=41.79;MQRankSum=-1.223;QD=13.97;ReadPosRankSum=-0.937;SOR=0.901 GT:AD:DP:GQ:PL 0/1:84,120:204:99:3812,0,2721 0/1:88,25:113:99:625,0,2792
scaffold_7232 453 . G A 5311.46 . AC=2;AF=0.500;AN=4;BaseQRankSum=2.043;DP=303;ExcessHet=4.7712;FS=7.804;MLEAC=2;MLEAF=0.500;MQ=40.00;MQRankSum=-0.946;QD=17.65;ReadPosRankSum=0.174;SOR=0.761 GT:AD:DP:GQ:PL 0/1:91,98:189:99:3866,0,5942 0/1:72,40:112:99:1455,0,3886
scaffold_7232 460 . T C 5174.46 . AC=2;AF=0.500;AN=4;BaseQRankSum=1.691;DP=300;ExcessHet=4.7712;FS=7.886;MLEAC=2;MLEAF=0.500;MQ=39.96;MQRankSum=-1.060;QD=17.36;ReadPosRankSum=-0.211;SOR=0.674 GT:AD:DP:GQ:PL 0/1:90,95:185:99:3727,0,5928 0/1:73,40:113:99:1457,0,3901
scaffold_7232 475 . G . Infinity . AN=4;DP=306;MQ=39.88 GT:AD:DP 0/0:194:194 0/0:112:112
scaffold_7232 476 . A . Infinity . AN=4;DP=305;MQ=39.90 GT:AD:DP 0/0:193:193 0/0:112:112
scaffold_7232 485 . G A 4907.46 . AC=2;AF=0.500;AN=4;BaseQRankSum=2.955;DP=313;ExcessHet=4.7712;FS=0.000;MLEAC=2;MLEAF=0.500;MQ=39.98;MQRankSum=-0.180;QD=15.73;ReadPosRankSum=-1.691;SOR=0.694 GT:AD:DP:GQ:PL 0/1:107,95:202:99:2997,0,3343 0/1:51,59:110:99:1920,0,1412
scaffold_7232 589 . T TAACTTAGGTTGTCTTAAAGAG 1148.91 . AC=1;AF=0.250;AN=4;BaseQRankSum=2.466;DP=286;ExcessHet=3.0103;FS=0.000;MLEAC=1;MLEAF=0.250;MQ=40.83;MQRankSum=-3.627;QD=6.64;ReadPosRankSum=-2.513;SOR=0.661 GT:AD:DP:GQ:PL 0/1:139,34:173:99:1157,0,6676 0/0:105,0:105:99:0,317,5193
scaffold_7232 592 . A C 2229.46 . AC=2;AF=0.500;AN=4;BaseQRankSum=2.278;DP=278;ExcessHet=4.7712;FS=6.428;MLEAC=2;MLEAF=0.500;MQ=40.93;MQRankSum=0.022;QD=8.02;ReadPosRankSum=-0.480;SOR=0.964 GT:AD:DP:GQ:PL 0/1:130,43:173:99:1242,0,4637 0/1:71,34:105:99:997,0,2331
scaffold_7232 682 . C CT 1404.91 . AC=1;AF=0.250;AN=4;BaseQRankSum=-3.692;DP=291;ExcessHet=3.0103;FS=7.626;MLEAC=1;MLEAF=0.250;MQ=43.48;MQRankSum=1.029;QD=13.01;ReadPosRankSum=-0.245;SOR=0.905 GT:AD:DP:GQ:PL 0/0:161,0:161:99:0,488,7902 0/1:68,40:108:99:1413,0,3038
scaffold_7232 696 . G A 1337.88 . AC=1;AF=0.250;AN=4;BaseQRankSum=-2.273;DP=287;ExcessHet=3.0103;FS=4.200;MLEAC=1;MLEAF=0.250;MQ=43.62;MQRankSum=0.599;QD=12.62;ReadPosRankSum=1.324;SOR=0.730 GT:AD:DP:GQ:PL 0/0:178,0:178:99:0,539,8590 0/1:69,37:106:99:1346,0,3079
scaffold_7232 874 . A . Infinity . AN=4;DP=284;MQ=42.99 GT:AD:DP 0/0:191:191 0/0:93:93
scaffold_7232 884 . C A 1741.46 . AC=2;AF=0.500;AN=4;BaseQRankSum=-1.238;DP=272;ExcessHet=4.7712;FS=3.370;MLEAC=2;MLEAF=0.500;MQ=42.96;MQRankSum=-0.331;QD=7.35;ReadPosRankSum=-1.538;SOR=0.486 GT:AD:DP:GQ:PL 0/1:113,43:156:99:1215,0,3899 0/1:59,22:81:99:536,0,2058
scaffold_7232 911 . C . Infinity . AN=4;DP=287;MQ=42.32 GT:AD:DP 0/0:197:197 0/0:90:90
'''

Note that the depth across the whole 1 kb scaffold is very high in each sample and that both mapping and base qualities are nearly all very high, so I don't understand why other monomorphic sites are not called as confident. When I repeat the same with the --output-mode option EMIT_ALL_SITES, I get the exact same sites called in the VCF file, with QUAL=Infinity. Also, when I call single individuals instead, I get the same output with Infinity QUAL fields and only a handfull of the almost 1000 covered sites.

I am happy to provide the files above for replicating the issues in a different context, please let me know how I can provide them.

Thank you and best wishes,
David

Issue · Github
by bhanuGandham

Issue Number
6063
State
open
Last Updated
Assignee
Array
Milestone
Array

Answers

Sign In or Register to comment.