what string represent 'PossibleDeNovo' annotated by VariantAnnotator?

I was trying to annotated Denovo muattion, and I tried VariantAnnotator, the tools works well and I found hiConfDeNovo/loConfDeNovo in VCF header.
##INFO=
##INFO=

However,I can't find 'hiConfDeNovo' or 'loConfDeNovo' or any string/value represent this in the list of variants.
this is how my variants lines look like:
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 63641 63652 63663
chr1 10492 rs55998931 C T 22.60 PASS AC=2;AF=0.333;AN=6;BaseQRankSum=-1.834e+00;ClippingRankSum=0.00;DB;DP=29;ExcessHet=3.9794;FS=0.0
00;MLEAC=2;MLEAF=0.500;MQ=36.46;MQRankSum=-4.310e-01;PG=0,0,0;QD=3.77;RAW_MQ=265
85.00;ReadPosRankSum=0.524;SOR=1.179 GT:AD:DP:GQ:JL:JP:PL:PP 0/1:4,2:6:49:-1:-1:48,0,128:49,0,132 0/0:0,0:0:0:.:.:0,0,0:0,0,0 0/1:9,0:9:2:-1:-1:0,0,25 9:2,0,261
chr1 10616 rs376342519 CCGCCGTTGCAAAGGCGCGCCG C 145.13 PASS
AC=2;AF=0.333;AN=6;DB;DP=7;ExcessHet=3.0103;FS=0.000;MLEAC=2;MLEAF=1.00;MQ=43.08;PG=0,0,0;QD=25.36;RAW_MQ=12990.00;SOR=3.258 GT:AD:DP:GQ:PL:PP 0/0:0,0:0:0:0,0,0:0,0,0 0/0:1,0:1:0:0,0,0:0,0,0 1/1:0,4:4:12:180,12,0:180,12,0
chr1 12807 rs62635285 C T 631.92 PASS AC=3;AF=0.500;AN
=6;BaseQRankSum=1.63;ClippingRankSum=0.00;DB;DP=66;ExcessHet=6.9897;FS=0.000;MLE
AC=3;MLEAF=0.500;MQ=19.28;MQRankSum=-3.598e+00;PG=0,0,0;QD=9.57;RAW_MQ=24540.00;
ReadPosRankSum=1.47;SOR=0.324 GT:AD:DP:GQ:JL:JP:PL:PP 0/1:10,9:19:99:127:127:232,0,363:232,0,363 0/1:27,10:37:99:127:127:217,0,998:217,0,998 0/1:4,6:10:99:127:127:213,0,128:213,0,128

So what is the different between the vcf file that annotated and before annotated , excepted the two lines in header

Best Answers

Answers

  • By the way, my gatk version is gatk-4.0.11.0
  • JinboWuGlasgowJinboWuGlasgow Member
    edited January 30
    I don't know why it cannot show header
  • @bhanuGandham Thanks for your reply.
    In my latest try, I used GATK3.7 to get 'hiConfDeNovo' annotation,but I failed again.
    here is my command:
    java -jar GenomeAnalysisTK.jar -T VariantAnnotator \
    -R chrALL.fa \
    -V input.vcf.gz \
    -o output.vcf.gz \
    -A PossibleDeNovo \
    --dbsnp dbsnp_146.hg38.vcf.gz \
    -ped Trio_Xten_GATK.ped

    my ped file:
    FAM001 father 0 0 1 1
    FAM001 mother 0 0 2 1
    FAM001 kid father mother 2 2

    some lines in output.vcf:
    chr1 12807 rs62635285 C T 631.92 PASS AC=3;AF=0.500;AN=6;BaseQRankSum=1.63;ClippingRankSum=0.00;DB;DP=66;ExcessHet=6.9897;FS=0.000;MLEAC=3;MLEAF=0.500;MQ=19.28;MQRankSum=-3.598e+00;PG=0,0,0;QD=9.57;RAW_MQ=24540.00;ReadPosRankSum=1.47;SOR=0.324 GT:AD:DP:GQ:JL:JP:PL:PP 0/1:10,9:19:99:127:127:232,0,363:232,0,363 0/1:27,10:37:99:127:127:217,0,998:217,0,998 0/1:4,6:10:99:127:127:213,0,128:213,0,128
    chr1 13079 . C G 96.68 PASS AC=2;AF=0.333;AN=6;BaseQRankSum=2.47;ClippingRankSum=0.00;DP=177;ExcessHet=3.6798;FS=19.779;MLEAC=1;MLEAF=0.167;MQ=50.31;MQRankSum=-4.439e+00;PG=0,0,0;QD=1.58;RAW_MQ=156930.00;ReadPosRankSum=-8.700e-01;SOR=4.174 GT:AD:DP:GQ:JL:JP:PL:PP 0/1:52,9:61:99:3:59:125,0,1653:122,0,1713 0/0:39,0:39:99:3:59:0,117,1646:0,114,1643 0/1:76,0:76:60:3:59:0,0,2362:60,0,2362
  • @bhanuGandham
    here is my full warning message
    INFO 10:07:33,114 HelpFormatter - ----------------------------------------------------------------------------------
    INFO 10:07:33,116 HelpFormatter - The Genome Analysis Toolkit (GATK) v3.7-0-gcfedb67, Compiled 2016/12/12 11:21:18
    INFO 10:07:33,116 HelpFormatter - Copyright (c) 2010-2016 The Broad Institute
    INFO 10:07:33,117 HelpFormatter - For support and documentation go to //software.broadinstitute.org/gatk
    INFO 10:07:33,117 HelpFormatter - [Mon Feb 11 10:07:33 CST 2019] Executing on Linux 2.6.32-696.30.1.el6.x86_64 amd64
    INFO 10:07:33,117 HelpFormatter - Java HotSpot(TM) 64-Bit Server VM 1.8.0_144-b01
    INFO 10:07:33,120 HelpFormatter - Program Args: -T VariantAnnotator -R /hwfssz3/COM/BC_COM_P9/Pipeline/Pipeline/HSAP/HSAP_v2.0/module/Alignment/Alignment_BWAmem/database/chrALL.fa -V /hwfssz3/BC_COM_P9/F17FTSECWLJ0893/HUMnccR/RD/wujinbo/DBSNP/output.withPosteriors_Filtered_withDBSNP.vcf.gz -o /hwfssz3/BC_COM_P9/F17FTSECWLJ0893/HUMnccR/RD/wujinbo/DBSNP/output.withPosteriors_preparedToAnnotated_withDBSNP.vcf.gz -A PossibleDeNovo --dbsnp /hwfssz3/COM/BC_COM_P9/Pipeline/Pipeline/HSAP/HSAP_v2.0/module/SNV/SNV_GATK/database/dbsnp_146.hg38.vcf.gz -ped /hwfssz3/BC_COM_P9/F17FTSECWLJ0893/HUMnccR/RD/wujinbo/Trio_Xten_GATK_test.ped -pedValidationType SILENT
    INFO 10:07:33,126 HelpFormatter - Executing as [email protected] on Linux 2.6.32-696.30.1.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_144-b01.
    INFO 10:07:33,127 HelpFormatter - Date/Time: 2019/02/11 10:07:33
    INFO 10:07:33,127 HelpFormatter - ----------------------------------------------------------------------------------
    INFO 10:07:33,127 HelpFormatter - ----------------------------------------------------------------------------------
    INFO 10:07:33,217 GenomeAnalysisEngine - Strictness is SILENT
    INFO 10:07:33,450 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 250
    WARN 10:07:33,838 IndexDictionaryUtils - Track variant doesn't have a sequence dictionary built in, skipping dictionary validation
    WARN 10:07:33,838 IndexDictionaryUtils - Track dbsnp doesn't have a sequence dictionary built in, skipping dictionary validation
    INFO 10:07:33,841 PedReader - Reading PED file /hwfssz3/BC_COM_P9/F17FTSECWLJ0893/HUMnccR/RD/wujinbo/Trio_Xten_GATK_test.ped with missing fields: []
    INFO 10:07:33,846 PedReader - Phenotype is other? false
    INFO 10:07:34,062 GenomeAnalysisEngine - Preparing for traversal
    INFO 10:07:34,067 GenomeAnalysisEngine - Done preparing for traversal
    INFO 10:07:34,067 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING]
    INFO 10:07:34,068 ProgressMeter - | processed | time | per 1M | | total | remaining
    INFO 10:07:34,068 ProgressMeter - Location | sites | elapsed | sites | completed | runtime | runtime
    INFO 10:08:04,083 ProgressMeter - chr1:50474201 5.0E7 30.0 s 0.0 s 1.6% 31.8 m 31.3 m
    INFO 10:08:34,084 ProgressMeter - chr1:113806101 1.13E8 60.0 s 0.0 s 3.5% 28.2 m 27.2 m
    INFO 10:09:04,086 ProgressMeter - chr1:186870201 1.86E8 90.0 s 0.0 s 5.8% 25.8 m 24.3 m
    INFO 10:09:34,088 ProgressMeter - chr1:248277001 2.48E8 120.0 s 0.0 s 7.7% 25.9 m 23.9 m
    INFO 10:10:04,089 ProgressMeter - chr2:57233301 3.05956422E8 2.5 m 0.0 s 9.5% 26.2 m 23.7 m
    INFO 10:10:34,090 ProgressMeter - chr2:120450301 3.68956422E8 3.0 m 0.0 s 11.5% 26.1 m 23.1 m
    INFO 10:11:04,092 ProgressMeter - chr2:181038301 4.29956422E8 3.5 m 0.0 s 13.4% 26.1 m 22.6 m
    INFO 10:11:34,094 ProgressMeter - chr3:1249501 4.92149951E8 4.0 m 0.0 s 15.3% 26.1 m 22.1 m
    INFO 10:12:04,095 ProgressMeter - chr3:60189901 5.51149951E8 4.5 m 0.0 s 17.2% 26.2 m 21.7 m
    INFO 10:12:34,097 ProgressMeter - chr3:122322601 6.13149951E8 5.0 m 0.0 s 19.1% 26.2 m 21.2 m
    INFO 10:13:04,098 ProgressMeter - chr3:184689901 6.75149951E8 5.5 m 0.0 s 21.1% 26.1 m 20.6 m
    INFO 10:13:34,100 ProgressMeter - chr4:43562801 7.3244551E8 6.0 m 0.0 s 22.8% 26.3 m 20.3 m
    INFO 10:14:04,106 ProgressMeter - chr4:104392201 7.9344551E8 6.5 m 0.0 s 24.7% 26.3 m 19.8 m
    INFO 10:14:34,108 ProgressMeter - chr4:166454101 8.5544551E8 7.0 m 0.0 s 26.7% 26.2 m 19.2 m
    INFO 10:15:04,110 ProgressMeter - chr5:34562701 9.13660065E8 7.5 m 0.0 s 28.5% 26.3 m 18.8 m
    INFO 10:15:34,111 ProgressMeter - chr5:100817601 9.79660065E8 8.0 m 0.0 s 30.6% 26.2 m 18.2 m
    INFO 10:16:04,131 ProgressMeter - chr5:161501501 1.040660065E9 8.5 m 0.0 s 32.4% 26.2 m 17.7 m
    INFO 10:16:34,132 ProgressMeter - chr6:38694101 1.099198324E9 9.0 m 0.0 s 34.3% 26.3 m 17.3 m
    INFO 10:17:04,133 ProgressMeter - chr6:100118201 1.161198324E9 9.5 m 0.0 s 36.2% 26.3 m 16.8 m
    INFO 10:17:34,135 ProgressMeter - chr6:161897801 1.222198324E9 10.0 m 0.0 s 38.1% 26.2 m 16.2 m
    INFO 10:18:04,136 ProgressMeter - chr7:47388901 1.279004303E9 10.5 m 0.0 s 39.9% 26.3 m 15.8 m
    INFO 10:18:34,138 ProgressMeter - chr7:107847101 1.339004303E9 11.0 m 0.0 s 41.7% 26.3 m 15.3 m
    INFO 10:19:04,139 ProgressMeter - chr8:6379001 1.397350276E9 11.5 m 0.0 s 43.6% 26.4 m 14.9 m
    INFO 10:19:34,141 ProgressMeter - chr8:63731301 1.454350276E9 12.0 m 0.0 s 45.3% 26.5 m 14.5 m
    INFO 10:20:04,142 ProgressMeter - chr8:126911101 1.517350276E9 12.5 m 0.0 s 47.3% 26.4 m 13.9 m
    INFO 10:20:34,143 ProgressMeter - chr9:37200301 1.573488912E9 13.0 m 0.0 s 49.0% 26.5 m 13.5 m
    INFO 10:21:04,145 ProgressMeter - chr9:110924401 1.646488912E9 13.5 m 0.0 s 51.3% 26.3 m 12.8 m
    INFO 10:21:34,146 ProgressMeter - chr10:29010801 1.703883629E9 14.0 m 0.0 s 53.1% 26.4 m 12.4 m
    INFO 10:22:04,148 ProgressMeter - chr10:89181301 1.763883629E9 14.5 m 0.0 s 55.0% 26.4 m 11.9 m
    INFO 10:22:34,149 ProgressMeter - chr11:12429101 1.820681051E9 15.0 m 0.0 s 56.7% 26.4 m 11.4 m
    INFO 10:23:04,150 ProgressMeter - chr11:71879601 1.879681051E9 15.5 m 0.0 s 58.6% 26.5 m 11.0 m
    INFO 10:23:34,152 ProgressMeter - chr11:131040601 1.939681051E9 16.0 m 0.0 s 60.4% 26.5 m 10.5 m
    INFO 10:24:04,153 ProgressMeter - chr12:54831901 1.997767673E9 16.5 m 0.0 s 62.3% 26.5 m 10.0 m
    INFO 10:24:34,155 ProgressMeter - chr12:116470101 2.059767673E9 17.0 m 0.0 s 64.2% 26.5 m 9.5 m
    INFO 10:25:04,157 ProgressMeter - chr13:52355601 2.129042982E9 17.5 m 0.0 s 66.4% 26.4 m 8.9 m
    INFO 10:25:34,158 ProgressMeter - chr13:113050001 2.190042982E9 18.0 m 0.0 s 68.2% 26.4 m 8.4 m
    INFO 10:26:04,161 ProgressMeter - chr14:70225501 2.26140731E9 18.5 m 0.0 s 70.5% 26.3 m 7.8 m
    INFO 10:26:34,162 ProgressMeter - chr15:36477801 2.334451028E9 19.0 m 0.0 s 72.8% 26.1 m 7.1 m
    INFO 10:27:04,165 ProgressMeter - chr15:95678301 2.393451028E9 19.5 m 0.0 s 74.6% 26.1 m 6.6 m
    INFO 10:27:34,166 ProgressMeter - chr16:56986901 2.456442217E9 20.0 m 0.0 s 76.6% 26.1 m 6.1 m
    INFO 10:28:04,168 ProgressMeter - chr17:20617601 2.510780562E9 20.5 m 0.0 s 78.3% 26.2 m 5.7 m
    INFO 10:28:34,172 ProgressMeter - chr17:81644801 2.571780562E9 21.0 m 0.0 s 80.2% 26.2 m 5.2 m
    INFO 10:29:04,174 ProgressMeter - chr18:60889301 2.634038003E9 21.5 m 0.0 s 82.1% 26.2 m 4.7 m
    INFO 10:29:34,175 ProgressMeter - chr19:36827801 2.690411288E9 22.0 m 0.0 s 83.9% 26.2 m 4.2 m
    INFO 10:30:04,177 ProgressMeter - chr20:34382501 2.747028904E9 22.5 m 0.0 s 85.6% 26.3 m 3.8 m
    INFO 10:30:34,178 ProgressMeter - chr21:33435201 2.810473071E9 23.0 m 0.0 s 87.6% 26.3 m 3.3 m
    INFO 10:31:04,180 ProgressMeter - chrX:1603401 2.876001522E9 23.5 m 0.0 s 89.6% 26.2 m 2.7 m
    INFO 10:31:34,182 ProgressMeter - chrX:98999201 2.973001522E9 24.0 m 0.0 s 92.7% 25.9 m 113.0 s
    INFO 10:32:04,185 ProgressMeter - GL383549.1:21901 3.094147444E9 24.5 m 0.0 s 96.4% 25.4 m 54.0 s
    INFO 10:32:24,156 VariantAnnotator - Processed 6340308 loci.

    INFO 10:32:24,478 ProgressMeter - done 3.209286105E9 24.8 m 0.0 s 100.0% 24.8 m 0.0 s
    INFO 10:32:24,479 ProgressMeter - Total runtime 1490.41 secs, 24.84 min, 0.41 hours
    ------------------------------------------------------------------------------------------
    Done.
    It looks quite good, I can't figure out where's the problem.
  • @bshifaw

    yes, I saw that, the answer is not every line would be annotated "hiConfDenovo"/"loConfDenovo", and if we used grep command we can see the annotated sites.
Sign In or Register to comment.