Holiday Notice:
The Frontline Support team will be offline February 18 for President's Day but will be back February 19th. Thank you for your patience as we get to all of your questions!

what string represent 'PossibleDeNovo' annotated by VariantAnnotator?

I was trying to annotated Denovo muattion, and I tried VariantAnnotator, the tools works well and I found hiConfDeNovo/loConfDeNovo in VCF header.
##INFO=
##INFO=

However,I can't find 'hiConfDeNovo' or 'loConfDeNovo' or any string/value represent this in the list of variants.
this is how my variants lines look like:
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 63641 63652 63663
chr1 10492 rs55998931 C T 22.60 PASS AC=2;AF=0.333;AN=6;BaseQRankSum=-1.834e+00;ClippingRankSum=0.00;DB;DP=29;ExcessHet=3.9794;FS=0.0
00;MLEAC=2;MLEAF=0.500;MQ=36.46;MQRankSum=-4.310e-01;PG=0,0,0;QD=3.77;RAW_MQ=265
85.00;ReadPosRankSum=0.524;SOR=1.179 GT:AD:DP:GQ:JL:JP:PL:PP 0/1:4,2:6:49:-1:-1:48,0,128:49,0,132 0/0:0,0:0:0:.:.:0,0,0:0,0,0 0/1:9,0:9:2:-1:-1:0,0,25 9:2,0,261
chr1 10616 rs376342519 CCGCCGTTGCAAAGGCGCGCCG C 145.13 PASS
AC=2;AF=0.333;AN=6;DB;DP=7;ExcessHet=3.0103;FS=0.000;MLEAC=2;MLEAF=1.00;MQ=43.08;PG=0,0,0;QD=25.36;RAW_MQ=12990.00;SOR=3.258 GT:AD:DP:GQ:PL:PP 0/0:0,0:0:0:0,0,0:0,0,0 0/0:1,0:1:0:0,0,0:0,0,0 1/1:0,4:4:12:180,12,0:180,12,0
chr1 12807 rs62635285 C T 631.92 PASS AC=3;AF=0.500;AN
=6;BaseQRankSum=1.63;ClippingRankSum=0.00;DB;DP=66;ExcessHet=6.9897;FS=0.000;MLE
AC=3;MLEAF=0.500;MQ=19.28;MQRankSum=-3.598e+00;PG=0,0,0;QD=9.57;RAW_MQ=24540.00;
ReadPosRankSum=1.47;SOR=0.324 GT:AD:DP:GQ:JL:JP:PL:PP 0/1:10,9:19:99:127:127:232,0,363:232,0,363 0/1:27,10:37:99:127:127:217,0,998:217,0,998 0/1:4,6:10:99:127:127:213,0,128:213,0,128

So what is the different between the vcf file that annotated and before annotated , excepted the two lines in header

Best Answer

Answers

  • By the way, my gatk version is gatk-4.0.11.0
  • JinboWuGlasgowJinboWuGlasgow Member
    edited January 30
    I don't know why it cannot show header
  • @bhanuGandham Thanks for your reply.
    In my latest try, I used GATK3.7 to get 'hiConfDeNovo' annotation,but I failed again.
    here is my command:
    java -jar GenomeAnalysisTK.jar -T VariantAnnotator \
    -R chrALL.fa \
    -V input.vcf.gz \
    -o output.vcf.gz \
    -A PossibleDeNovo \
    --dbsnp dbsnp_146.hg38.vcf.gz \
    -ped Trio_Xten_GATK.ped

    my ped file:
    FAM001 father 0 0 1 1
    FAM001 mother 0 0 2 1
    FAM001 kid father mother 2 2

    some lines in output.vcf:
    chr1 12807 rs62635285 C T 631.92 PASS AC=3;AF=0.500;AN=6;BaseQRankSum=1.63;ClippingRankSum=0.00;DB;DP=66;ExcessHet=6.9897;FS=0.000;MLEAC=3;MLEAF=0.500;MQ=19.28;MQRankSum=-3.598e+00;PG=0,0,0;QD=9.57;RAW_MQ=24540.00;ReadPosRankSum=1.47;SOR=0.324 GT:AD:DP:GQ:JL:JP:PL:PP 0/1:10,9:19:99:127:127:232,0,363:232,0,363 0/1:27,10:37:99:127:127:217,0,998:217,0,998 0/1:4,6:10:99:127:127:213,0,128:213,0,128
    chr1 13079 . C G 96.68 PASS AC=2;AF=0.333;AN=6;BaseQRankSum=2.47;ClippingRankSum=0.00;DP=177;ExcessHet=3.6798;FS=19.779;MLEAC=1;MLEAF=0.167;MQ=50.31;MQRankSum=-4.439e+00;PG=0,0,0;QD=1.58;RAW_MQ=156930.00;ReadPosRankSum=-8.700e-01;SOR=4.174 GT:AD:DP:GQ:JL:JP:PL:PP 0/1:52,9:61:99:3:59:125,0,1653:122,0,1713 0/0:39,0:39:99:3:59:0,117,1646:0,114,1643 0/1:76,0:76:60:3:59:0,0,2362:60,0,2362
  • @bhanuGandham
    here is my full warning message
    INFO 10:07:33,114 HelpFormatter - ----------------------------------------------------------------------------------
    INFO 10:07:33,116 HelpFormatter - The Genome Analysis Toolkit (GATK) v3.7-0-gcfedb67, Compiled 2016/12/12 11:21:18
    INFO 10:07:33,116 HelpFormatter - Copyright (c) 2010-2016 The Broad Institute
    INFO 10:07:33,117 HelpFormatter - For support and documentation go to //software.broadinstitute.org/gatk
    INFO 10:07:33,117 HelpFormatter - [Mon Feb 11 10:07:33 CST 2019] Executing on Linux 2.6.32-696.30.1.el6.x86_64 amd64
    INFO 10:07:33,117 HelpFormatter - Java HotSpot(TM) 64-Bit Server VM 1.8.0_144-b01
    INFO 10:07:33,120 HelpFormatter - Program Args: -T VariantAnnotator -R /hwfssz3/COM/BC_COM_P9/Pipeline/Pipeline/HSAP/HSAP_v2.0/module/Alignment/Alignment_BWAmem/database/chrALL.fa -V /hwfssz3/BC_COM_P9/F17FTSECWLJ0893/HUMnccR/RD/wujinbo/DBSNP/output.withPosteriors_Filtered_withDBSNP.vcf.gz -o /hwfssz3/BC_COM_P9/F17FTSECWLJ0893/HUMnccR/RD/wujinbo/DBSNP/output.withPosteriors_preparedToAnnotated_withDBSNP.vcf.gz -A PossibleDeNovo --dbsnp /hwfssz3/COM/BC_COM_P9/Pipeline/Pipeline/HSAP/HSAP_v2.0/module/SNV/SNV_GATK/database/dbsnp_146.hg38.vcf.gz -ped /hwfssz3/BC_COM_P9/F17FTSECWLJ0893/HUMnccR/RD/wujinbo/Trio_Xten_GATK_test.ped -pedValidationType SILENT
    INFO 10:07:33,126 HelpFormatter - Executing as [email protected] on Linux 2.6.32-696.30.1.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_144-b01.
    INFO 10:07:33,127 HelpFormatter - Date/Time: 2019/02/11 10:07:33
    INFO 10:07:33,127 HelpFormatter - ----------------------------------------------------------------------------------
    INFO 10:07:33,127 HelpFormatter - ----------------------------------------------------------------------------------
    INFO 10:07:33,217 GenomeAnalysisEngine - Strictness is SILENT
    INFO 10:07:33,450 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 250
    WARN 10:07:33,838 IndexDictionaryUtils - Track variant doesn't have a sequence dictionary built in, skipping dictionary validation
    WARN 10:07:33,838 IndexDictionaryUtils - Track dbsnp doesn't have a sequence dictionary built in, skipping dictionary validation
    INFO 10:07:33,841 PedReader - Reading PED file /hwfssz3/BC_COM_P9/F17FTSECWLJ0893/HUMnccR/RD/wujinbo/Trio_Xten_GATK_test.ped with missing fields: []
    INFO 10:07:33,846 PedReader - Phenotype is other? false
    INFO 10:07:34,062 GenomeAnalysisEngine - Preparing for traversal
    INFO 10:07:34,067 GenomeAnalysisEngine - Done preparing for traversal
    INFO 10:07:34,067 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING]
    INFO 10:07:34,068 ProgressMeter - | processed | time | per 1M | | total | remaining
    INFO 10:07:34,068 ProgressMeter - Location | sites | elapsed | sites | completed | runtime | runtime
    INFO 10:08:04,083 ProgressMeter - chr1:50474201 5.0E7 30.0 s 0.0 s 1.6% 31.8 m 31.3 m
    INFO 10:08:34,084 ProgressMeter - chr1:113806101 1.13E8 60.0 s 0.0 s 3.5% 28.2 m 27.2 m
    INFO 10:09:04,086 ProgressMeter - chr1:186870201 1.86E8 90.0 s 0.0 s 5.8% 25.8 m 24.3 m
    INFO 10:09:34,088 ProgressMeter - chr1:248277001 2.48E8 120.0 s 0.0 s 7.7% 25.9 m 23.9 m
    INFO 10:10:04,089 ProgressMeter - chr2:57233301 3.05956422E8 2.5 m 0.0 s 9.5% 26.2 m 23.7 m
    INFO 10:10:34,090 ProgressMeter - chr2:120450301 3.68956422E8 3.0 m 0.0 s 11.5% 26.1 m 23.1 m
    INFO 10:11:04,092 ProgressMeter - chr2:181038301 4.29956422E8 3.5 m 0.0 s 13.4% 26.1 m 22.6 m
    INFO 10:11:34,094 ProgressMeter - chr3:1249501 4.92149951E8 4.0 m 0.0 s 15.3% 26.1 m 22.1 m
    INFO 10:12:04,095 ProgressMeter - chr3:60189901 5.51149951E8 4.5 m 0.0 s 17.2% 26.2 m 21.7 m
    INFO 10:12:34,097 ProgressMeter - chr3:122322601 6.13149951E8 5.0 m 0.0 s 19.1% 26.2 m 21.2 m
    INFO 10:13:04,098 ProgressMeter - chr3:184689901 6.75149951E8 5.5 m 0.0 s 21.1% 26.1 m 20.6 m
    INFO 10:13:34,100 ProgressMeter - chr4:43562801 7.3244551E8 6.0 m 0.0 s 22.8% 26.3 m 20.3 m
    INFO 10:14:04,106 ProgressMeter - chr4:104392201 7.9344551E8 6.5 m 0.0 s 24.7% 26.3 m 19.8 m
    INFO 10:14:34,108 ProgressMeter - chr4:166454101 8.5544551E8 7.0 m 0.0 s 26.7% 26.2 m 19.2 m
    INFO 10:15:04,110 ProgressMeter - chr5:34562701 9.13660065E8 7.5 m 0.0 s 28.5% 26.3 m 18.8 m
    INFO 10:15:34,111 ProgressMeter - chr5:100817601 9.79660065E8 8.0 m 0.0 s 30.6% 26.2 m 18.2 m
    INFO 10:16:04,131 ProgressMeter - chr5:161501501 1.040660065E9 8.5 m 0.0 s 32.4% 26.2 m 17.7 m
    INFO 10:16:34,132 ProgressMeter - chr6:38694101 1.099198324E9 9.0 m 0.0 s 34.3% 26.3 m 17.3 m
    INFO 10:17:04,133 ProgressMeter - chr6:100118201 1.161198324E9 9.5 m 0.0 s 36.2% 26.3 m 16.8 m
    INFO 10:17:34,135 ProgressMeter - chr6:161897801 1.222198324E9 10.0 m 0.0 s 38.1% 26.2 m 16.2 m
    INFO 10:18:04,136 ProgressMeter - chr7:47388901 1.279004303E9 10.5 m 0.0 s 39.9% 26.3 m 15.8 m
    INFO 10:18:34,138 ProgressMeter - chr7:107847101 1.339004303E9 11.0 m 0.0 s 41.7% 26.3 m 15.3 m
    INFO 10:19:04,139 ProgressMeter - chr8:6379001 1.397350276E9 11.5 m 0.0 s 43.6% 26.4 m 14.9 m
    INFO 10:19:34,141 ProgressMeter - chr8:63731301 1.454350276E9 12.0 m 0.0 s 45.3% 26.5 m 14.5 m
    INFO 10:20:04,142 ProgressMeter - chr8:126911101 1.517350276E9 12.5 m 0.0 s 47.3% 26.4 m 13.9 m
    INFO 10:20:34,143 ProgressMeter - chr9:37200301 1.573488912E9 13.0 m 0.0 s 49.0% 26.5 m 13.5 m
    INFO 10:21:04,145 ProgressMeter - chr9:110924401 1.646488912E9 13.5 m 0.0 s 51.3% 26.3 m 12.8 m
    INFO 10:21:34,146 ProgressMeter - chr10:29010801 1.703883629E9 14.0 m 0.0 s 53.1% 26.4 m 12.4 m
    INFO 10:22:04,148 ProgressMeter - chr10:89181301 1.763883629E9 14.5 m 0.0 s 55.0% 26.4 m 11.9 m
    INFO 10:22:34,149 ProgressMeter - chr11:12429101 1.820681051E9 15.0 m 0.0 s 56.7% 26.4 m 11.4 m
    INFO 10:23:04,150 ProgressMeter - chr11:71879601 1.879681051E9 15.5 m 0.0 s 58.6% 26.5 m 11.0 m
    INFO 10:23:34,152 ProgressMeter - chr11:131040601 1.939681051E9 16.0 m 0.0 s 60.4% 26.5 m 10.5 m
    INFO 10:24:04,153 ProgressMeter - chr12:54831901 1.997767673E9 16.5 m 0.0 s 62.3% 26.5 m 10.0 m
    INFO 10:24:34,155 ProgressMeter - chr12:116470101 2.059767673E9 17.0 m 0.0 s 64.2% 26.5 m 9.5 m
    INFO 10:25:04,157 ProgressMeter - chr13:52355601 2.129042982E9 17.5 m 0.0 s 66.4% 26.4 m 8.9 m
    INFO 10:25:34,158 ProgressMeter - chr13:113050001 2.190042982E9 18.0 m 0.0 s 68.2% 26.4 m 8.4 m
    INFO 10:26:04,161 ProgressMeter - chr14:70225501 2.26140731E9 18.5 m 0.0 s 70.5% 26.3 m 7.8 m
    INFO 10:26:34,162 ProgressMeter - chr15:36477801 2.334451028E9 19.0 m 0.0 s 72.8% 26.1 m 7.1 m
    INFO 10:27:04,165 ProgressMeter - chr15:95678301 2.393451028E9 19.5 m 0.0 s 74.6% 26.1 m 6.6 m
    INFO 10:27:34,166 ProgressMeter - chr16:56986901 2.456442217E9 20.0 m 0.0 s 76.6% 26.1 m 6.1 m
    INFO 10:28:04,168 ProgressMeter - chr17:20617601 2.510780562E9 20.5 m 0.0 s 78.3% 26.2 m 5.7 m
    INFO 10:28:34,172 ProgressMeter - chr17:81644801 2.571780562E9 21.0 m 0.0 s 80.2% 26.2 m 5.2 m
    INFO 10:29:04,174 ProgressMeter - chr18:60889301 2.634038003E9 21.5 m 0.0 s 82.1% 26.2 m 4.7 m
    INFO 10:29:34,175 ProgressMeter - chr19:36827801 2.690411288E9 22.0 m 0.0 s 83.9% 26.2 m 4.2 m
    INFO 10:30:04,177 ProgressMeter - chr20:34382501 2.747028904E9 22.5 m 0.0 s 85.6% 26.3 m 3.8 m
    INFO 10:30:34,178 ProgressMeter - chr21:33435201 2.810473071E9 23.0 m 0.0 s 87.6% 26.3 m 3.3 m
    INFO 10:31:04,180 ProgressMeter - chrX:1603401 2.876001522E9 23.5 m 0.0 s 89.6% 26.2 m 2.7 m
    INFO 10:31:34,182 ProgressMeter - chrX:98999201 2.973001522E9 24.0 m 0.0 s 92.7% 25.9 m 113.0 s
    INFO 10:32:04,185 ProgressMeter - GL383549.1:21901 3.094147444E9 24.5 m 0.0 s 96.4% 25.4 m 54.0 s
    INFO 10:32:24,156 VariantAnnotator - Processed 6340308 loci.

    INFO 10:32:24,478 ProgressMeter - done 3.209286105E9 24.8 m 0.0 s 100.0% 24.8 m 0.0 s
    INFO 10:32:24,479 ProgressMeter - Total runtime 1490.41 secs, 24.84 min, 0.41 hours
    ------------------------------------------------------------------------------------------
    Done.
    It looks quite good, I can't figure out where's the problem.
  • bshifawbshifaw moonMember, Broadie, Moderator admin

    Looks like this question is being answered in the following thread: https://gatkforums.broadinstitute.org/gatk/discussion/comment/56290#Comment_56290

  • @bshifaw

    yes, I saw that, the answer is not every line would be annotated "hiConfDenovo"/"loConfDenovo", and if we used grep command we can see the annotated sites.
Sign In or Register to comment.