A strange INDEL with AD and DP are zeros

Hi there,

Here is the mutation.

4   5858712 .   G   GTTATCACCACTATCATTATCACCCCACCACCATCATCACCATCACCACCACCACCATCATCATTACTAACATTATCACCACCACCACCATCACCACCATCATCACCACCGCCACCATCCACTATCATCACCACCATCCACTA,GTTATCACCACTATCATTATCACCCCACCACCATCATCACCATCACCACCACCACCATCATCATTACTAACATTATCACCACCACCACCATCACCACCATCATCACCACCGCCACCATCCACTATCATCACCACCATCCACTATCATCACCACCATCCACTA  1155.73 .   AC=1,1;AF=0.500,0.500;AN=2;DP=15;ExcessHet=3.0103;FS=0.000;MLEAC=1,1;MLEAF=0.500,0.500;MQ=60.00;SOR=0.693   GT:AD:DP:GQ:PL  1/2:0,0,0:0:99:1193,321,251,263,0,191

Why it call out the mutation but the AD and DP in FORMAT are both zeros. Is this mutation can be trusted or not?

Best Answer

Answers

Sign In or Register to comment.