Holiday Notice:
The Frontline Support team will be offline February 18 for President's Day but will be back February 19th. Thank you for your patience as we get to all of your questions!

Badly formed genome location: Parameters to GenomeLocParser are incorrect (CombineVariants)

talwar_jtalwar_j Member
edited January 15 in Ask the GATK team
Hello,

I am using GATK version 3.8.1 (3.8-1-0-gf15c1c3ef) and wanted to merge 4 vcf files using the CombineVariants command.
The command i am using is here:

java -jar GenomeAnalysisTK.jar \
-T CombineVariants -R genome.fa \
-nt 20 \
--variant a.vcf \
--variant b.vcf \
--variant c.vcf \
--variant d.vcf \
-o Combined.vcf \
-genotypeMergeOptions UNIQUIFY

However after running for a while i get this error:
##### ERROR MESSAGE: Badly formed genome location: Parameters to GenomeLocParser are incorrect:The stop position 136765 is less than start 199815 in contig 19

When i check in the file (d.vcf) there is indeed a variant line:
19 199815 BND00000924 C C[1:136765[ . LowQual PRECISE;SVTYPE=BND;SVMETHOD=EMBL.DELLYv0.7.9;CHR2=1;END=136765;PE=2;MAPQ=24;CT=3to5;CIPOS=-33,33;CIEND=-33,33;INSLEN=0;HOMLEN=34;SR=10;SRQ=0.953271;CONSENSUS=GGGTGTGAGGCAAGGGGCTCACGCTGACCTCTGTCCGCGTGGGAGGGGCCGGTGTGAGGCAAGGGGCTCGGGCTGACCTCTCTCAGCGTGGGAGGGGGCGGGG;CE=1.77046 GT:GL:GQ:FT:RCL:RC:RCR:CN:DR:DV:RR:RV 0/0:0,-11.8581,-97.1159:119:PASS:43:174:379:1:61:0:41:0 0/0:0,-34.4186,-340.549:10000:PASS:195:1022:1304:1:228:0:139:4


The problem i think is that the merging tool is looking at the INFO/END tag and determining the end location of the translocation. But it ignores the INFO/CHR2 tag, which provides the information that the Translocation spans across different chromosomes.

Is there something wrong in the way my vcf file is organised (it is vcf v.4.2)?

Is there way to remove this error? Thank you very much for your help/support!

Best Answer

  • bhanuGandhambhanuGandham admin
    Accepted Answer

    HI @talwar_j

    After asking around it sounds like the variant isn't actually valid for a structural variant entry - it shouldn't have an END field. The end is actually specified in the alt allele field as C[1:136765[. Long story short, if you remove the END=... annotation from the VCF it should work.

Answers

Sign In or Register to comment.