The current GATK version is 3.7-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Get notifications!


You can opt in to receive email notifications, for example when your questions get answered or when there are new announcements, by following the instructions given here.

Got a problem?


1. Search using the upper-right search box, e.g. using the error message.
2. Try the latest version of tools.
3. Include tool and Java versions.
4. Tell us whether you are following GATK Best Practices.
5. Include relevant details, e.g. platform, DNA- or RNA-Seq, WES (+capture kit) or WGS (PCR-free or PCR+), paired- or single-end, read length, expected average coverage, somatic data, etc.
6. For tool errors, include the error stacktrace as well as the exact command.
7. For format issues, include the result of running ValidateSamFile for BAMs or ValidateVariants for VCFs.
8. For weird results, include an illustrative example, e.g. attach IGV screenshots according to Article#5484.
9. For a seeming variant that is uncalled, include results of following Article#1235.

Did we ask for a bug report?


Then follow instructions in Article#1894.

Formatting tip!


Wrap blocks of code, error messages and BAM/VCF snippets--especially content with hashes (#)--with lines with three backticks ( ``` ) each to make a code block as demonstrated here.

Jump to another community
Picard 2.10.4 has MAJOR CHANGES that impact throughput of pipelines. Default compression is now 1 instead of 5, and Picard now handles compressed data with the Intel Deflator/Inflator instead of JDK.
GATK version 4.beta.2 (i.e. the second beta release) is out. See the GATK4 BETA page for download and details.

Different annotations for same co-ordinates in vcf

tinutinu Member
edited January 2013 in Ask the GATK team

Please look at lines 1 and 2 taken from a vcf file, which have same Chromosome and Position and one of the Alt allele is same in both lines, different allele count and have different rsID.

1 1229111 rs70949568 A ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC,C 2629.32 TruthSensitivityTranche99.50to99.90;TruthSensitivityTranche99.30to99.50 AC=80,31;AF=0.1273;AN=284;BaseQRankSum=1.124;DB;DP=426;Dels=0.00;FS=4.620;HRun=1;HaplotypeScore=0.2101;InbreedingCoeff=-0.0029;MQ0=0;MQ=58.46;MQRankSum=1.211;QD=5.26;ReadPosRankSum=-5.748;SB=-36.94;SF=0f,1f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-2.3894;culprit=MQ GT:DP:GQ:AD:PL

1 1229111 . A C 89.94 TruthSensitivityTranche99.00to99.30 AC=7;AF=0.0614;AN=114;BaseQRankSum=0.801;DP=175;Dels=0.00;FS=1.668;HRun=1;HaplotypeScore=0.2276;InbreedingCoeff=-0.0538;MQ0=0;MQ=57.90;MQRankSum=0.501;QD=4.28;ReadPosRankSum=-4.531;SB=-15.19;SF=0f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-1.4433;culprit=MQ GT:DP:GQ:AD:PL

Post edited by Geraldine_VdAuwera on
Tagged:

Best Answer

Answers

  • The annotations are correct, rs70949568 is the insertion in Line 1: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=70949568

  • Thanks.

    But my doubt is according to the lines mentioned, for rs70949568 there are 2 Alternate Alleles (ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC and C). The Alternate Allele 'C' for rs70949568 fmeans that it is a SNP which changes from Ref Allele 'A' to 'C'

    Now for the second line which is the same Chr and Pos repeated again in the same vcf, the Alternate Allele is again C, which was mentioned as one of the Ref allele for rs70949568 and both lines have same Ref Allele.

    So my doubt is why should we have same change A to C mentioned in 2 lines.

Sign In or Register to comment.