Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.
Attention:
We will be out of the office on October 14, 2019, due to the U.S. holiday. We will return to monitoring the forum on October 15.

Different annotations for same co-ordinates in vcf

tinutinu Member
edited January 2013 in Ask the GATK team

Please look at lines 1 and 2 taken from a vcf file, which have same Chromosome and Position and one of the Alt allele is same in both lines, different allele count and have different rsID.

1 1229111 rs70949568 A ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC,C 2629.32 TruthSensitivityTranche99.50to99.90;TruthSensitivityTranche99.30to99.50 AC=80,31;AF=0.1273;AN=284;BaseQRankSum=1.124;DB;DP=426;Dels=0.00;FS=4.620;HRun=1;HaplotypeScore=0.2101;InbreedingCoeff=-0.0029;MQ0=0;MQ=58.46;MQRankSum=1.211;QD=5.26;ReadPosRankSum=-5.748;SB=-36.94;SF=0f,1f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-2.3894;culprit=MQ GT:DP:GQ:AD:PL

1 1229111 . A C 89.94 TruthSensitivityTranche99.00to99.30 AC=7;AF=0.0614;AN=114;BaseQRankSum=0.801;DP=175;Dels=0.00;FS=1.668;HRun=1;HaplotypeScore=0.2276;InbreedingCoeff=-0.0538;MQ0=0;MQ=57.90;MQRankSum=0.501;QD=4.28;ReadPosRankSum=-4.531;SB=-15.19;SF=0f;SNPEFF_EFFECT=DOWNSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=protein_coding;SNPEFF_GENE_NAME=ACAP3;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000379037;VQSLOD=-1.4433;culprit=MQ GT:DP:GQ:AD:PL

Post edited by Geraldine_VdAuwera on
Tagged:

Best Answer

Answers

  • pdexheimerpdexheimer ✭✭✭✭ Member ✭✭✭✭

    The annotations are correct, rs70949568 is the insertion in Line 1: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=70949568

  • tinutinu Member

    Thanks.

    But my doubt is according to the lines mentioned, for rs70949568 there are 2 Alternate Alleles (ACGCCCCTGCCCTGGAGGCCCCGCCCCTGCCCTGGAGGCCC and C). The Alternate Allele 'C' for rs70949568 fmeans that it is a SNP which changes from Ref Allele 'A' to 'C'

    Now for the second line which is the same Chr and Pos repeated again in the same vcf, the Alternate Allele is again C, which was mentioned as one of the Ref allele for rs70949568 and both lines have same Ref Allele.

    So my doubt is why should we have same change A to C mentioned in 2 lines.

Sign In or Register to comment.