How to make Picard and BWA compatible for mtDNA

ericminikelericminikel Member
edited January 2013 in Ask the GATK team

Picard appears not to like the way BWA codes mtDNA. I am doing human exome sequencing using a copy of hg19 which I obtained from UCSC and indexed using BWA per the instructions here:

Example 1

[Tue Aug 28 12:45:16 EDT 2012] net.sf.picard.sam.SortSam done. Elapsed time: 0.01 minutes.
Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. Non-numeric value in ISIZE column; Line 3982
Line: FCC0CHTACXX:1:1101:14789:3170#TAGCTTAT 117 chrM 304415842 0 100M = -1610645157 2379906297 TGCGACTTGGAAGCGGATTCAGAGGACAGGACAGAACACTTGGGCAAGTGAATCTCTGTCTGTCTGTCTGTCTCATTGGTTGGTTTATTTCCATTTTCTT [email protected]<:>[email protected]JJJIJIJIJJJJIJJJGIHHGHFFEFFFCCC RG:Z:1868 XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:2 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:39G45G14 XA:Z:chrM,-391302964,100M,2;
at net.sf.samtools.SAMTextReader.reportFatalErrorParsingLine(
at net.sf.samtools.SAMTextReader.access$400(
at net.sf.samtools.SAMTextReader$RecordIterator.parseInt(
at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(
at net.sf.samtools.SAMTextReader$
at net.sf.samtools.SAMTextReader$
at net.sf.samtools.SAMFileReader$
at net.sf.samtools.SAMFileReader$
at net.sf.picard.sam.SortSam.doWork(
at net.sf.picard.cmdline.CommandLineProgram.instanceMain(
at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(
at net.sf.picard.sam.SortSam.main(

Example 2

java -jar ~/bin/picard-tools-1.74/MarkDuplicates.jar \
INPUT=1sorted.bam \
OUTPUT=1dedup.bam \
METRICS_FILE=metrics \

Ignoring SAM validation error: ERROR: Record 691, Read name FCC0CHTACXX:1:1302:4748:176644#GGCTACAT, Mate Alignment start (436154938) must be <= reference sequence length (16571) on reference chrM
Ignoring SAM validation error: ERROR: Record 692, Read name FCC0CHTACXX:1:2104:8494:167812#GGCTACAT, Mate Alignment start should != 0 because reference name != *.
Ignoring SAM validation error: ERROR: Record 693, Read name FCC0CHTACXX:1:1201:21002:183608#GGCTACAT, Mate Alignment start should != 0 because reference name != *.
Ignoring SAM validation error: ERROR: Record 694, Read name FCC0CHTACXX:1:2303:3184:35872#GGCTACAT, Mate Alignment start (436154812) must be <= reference sequence length (16571) on reference chrM

I've truncated the output; in fact it throws such an error for every single line of mitochondrial reads.

I suspect I could solve this by writing my own script to go in and change the way one column is coded, but more broadly, I am interested in the answer to "how do you make BWA, Picard and GATK work seamlessly together without needing to do your own scripting"?

Post edited by Geraldine_VdAuwera on

Best Answer


Sign In or Register to comment.