The current GATK version is 3.7-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Get notifications!


You can opt in to receive email notifications, for example when your questions get answered or when there are new announcements, by following the instructions given here.

Got a problem?


1. Search using the upper-right search box, e.g. using the error message.
2. Try the latest version of tools.
3. Include tool and Java versions.
4. Tell us whether you are following GATK Best Practices.
5. Include relevant details, e.g. platform, DNA- or RNA-Seq, WES (+capture kit) or WGS (PCR-free or PCR+), paired- or single-end, read length, expected average coverage, somatic data, etc.
6. For tool errors, include the error stacktrace as well as the exact command.
7. For format issues, include the result of running ValidateSamFile for BAMs or ValidateVariants for VCFs.
8. For weird results, include an illustrative example, e.g. attach IGV screenshots according to Article#5484.
9. For a seeming variant that is uncalled, include results of following Article#1235.

Did we ask for a bug report?


Then follow instructions in Article#1894.

Formatting tip!


Wrap blocks of code, error messages and BAM/VCF snippets--especially content with hashes (#)--with lines with three backticks ( ``` ) each to make a code block as demonstrated here.

Jump to another community
Picard 2.10.2 is now available at https://github.com/broadinstitute/picard/releases.
GATK version 4.beta.2 (i.e. the second beta release) is out. See the GATK4 BETA page for download and details.

How to make Picard and BWA compatible for mtDNA

ericminikelericminikel Member
edited January 2013 in Ask the GATK team

Picard appears not to like the way BWA codes mtDNA. I am doing human exome sequencing using a copy of hg19 which I obtained from UCSC and indexed using BWA per the instructions here:

Example 1

[Tue Aug 28 12:45:16 EDT 2012] net.sf.picard.sam.SortSam done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=125435904
FAQ: http://sourceforge.net/apps/mediawiki/picard/index.php?title=Main_Page
Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. Non-numeric value in ISIZE column; Line 3982
Line: FCC0CHTACXX:1:1101:14789:3170#TAGCTTAT 117 chrM 304415842 0 100M = -1610645157 2379906297 TGCGACTTGGAAGCGGATTCAGAGGACAGGACAGAACACTTGGGCAAGTGAATCTCTGTCTGTCTGTCTGTCTCATTGGTTGGTTTATTTCCATTTTCTT B@<:>CDDDBDDBDEEEEEEFEFCCHHFHHGGIIIHIGJJJIIGGGIIIIJJJIIGJIJGG@CEIFJIJJJJIJIJIJJJJIJJJGIHHGHFFEFFFCCC RG:Z:1868 XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:2 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:39G45G14 XA:Z:chrM,-391302964,100M,2;
at net.sf.samtools.SAMTextReader.reportFatalErrorParsingLine(SAMTextReader.java:223)
at net.sf.samtools.SAMTextReader.access$400(SAMTextReader.java:40)
at net.sf.samtools.SAMTextReader$RecordIterator.parseInt(SAMTextReader.java:293)
at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:394)
at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:278)
at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:250)
at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:641)
at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:619)
at net.sf.picard.sam.SortSam.doWork(SortSam.java:68)
at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:119)
at net.sf.picard.sam.SortSam.main(SortSam.java:57)

Example 2

java -jar ~/bin/picard-tools-1.74/MarkDuplicates.jar \
INPUT=1sorted.bam \
OUTPUT=1dedup.bam \
ASSUME_SORTED=true \
METRICS_FILE=metrics \
CREATE_INDEX=true \
VALIDATION_STRINGENCY=LENIENT

...
Ignoring SAM validation error: ERROR: Record 691, Read name FCC0CHTACXX:1:1302:4748:176644#GGCTACAT, Mate Alignment start (436154938) must be <= reference sequence length (16571) on reference chrM
Ignoring SAM validation error: ERROR: Record 692, Read name FCC0CHTACXX:1:2104:8494:167812#GGCTACAT, Mate Alignment start should != 0 because reference name != *.
Ignoring SAM validation error: ERROR: Record 693, Read name FCC0CHTACXX:1:1201:21002:183608#GGCTACAT, Mate Alignment start should != 0 because reference name != *.
Ignoring SAM validation error: ERROR: Record 694, Read name FCC0CHTACXX:1:2303:3184:35872#GGCTACAT, Mate Alignment start (436154812) must be <= reference sequence length (16571) on reference chrM
...

I've truncated the output; in fact it throws such an error for every single line of mitochondrial reads.

I suspect I could solve this by writing my own script to go in and change the way one column is coded, but more broadly, I am interested in the answer to "how do you make BWA, Picard and GATK work seamlessly together without needing to do your own scripting"?

Post edited by Geraldine_VdAuwera on
Tagged:

Best Answer

Answers

Sign In or Register to comment.