We've moved!
This site is now read-only. You can find our new documentation site and support forum for posting questions here.
Be sure to read our welcome blog!

countcovariates help

rkkrkk Member
edited August 2012 in Ask the GATK team

I am running SNP calling pipeline on our recent single end RNA-seq data. I got struck at "CountCovariates" step.

Command line is:

GATK_JAVA_OPTS=-Xmx14G

java $GATK_JAVA_OPTS -jar $GATK_HOME/GenomeAnalysisTK.jar -T CountCovariates -R hg19_canonical_ordered.fasta -I accepted_hits.filtered.dups_marked.cleaned.readgrouped.canonical.ordered.realigned.bam -knownSites dbsnp_132.hg19.vcf -cov QualityScoreCovariate -cov CycleCovariate -cov DinucCovariate -recalFile recal_data.csv

.err file from SGE script shows

ERROR MESSAGE: Bad input: Could not find any usable data in the input BAM file(s).

.out file from SGE script shows
INFO 14:41:00,621 HttpMethodDirector - I/O exception (java.net.SocketException) caught when processing request: Connection reset
INFO 14:41:00,621 HttpMethodDirector - Retrying request

But my bam file is not corrupted,

HWI-ST1022:116:DOWWVACXX:3:1104:2641:4334 0 chrM 1 255 50M * 0 0 GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT %&&((((((***+++++++++++++++++++++++++++++++++++++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:1207:5103:38045 0 chrM 2 255 50M * 0 0 ATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATT &&&(((((&
(+++++++++++++++++++++++++++++++++++++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:1210:20536:6166 1024 chrM 2 255 50M * 0 0 ATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATT &&&(((((*****+++++++++++++++++++++++++++++++++++++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:1316:12851:33446 1024 chrM 2 255 50M * 0 0 ATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATT %$&&((((***(++++++++++)++')++++++++++++++)+*++++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:2211:11955:84132 1024 chrM 2 255 50M * 0 0 ATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATT &&&((((((****++++++++++++++++++++++)+)++++++++++++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:2311:10140:59952 1024 chrM 2 255 50M * 0 0 ATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATT $$$&((((%&(
#)++++++++++++&++#&)%&+++++))$&(+ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:1307:13084:49882 0 chrM 3 255 50M * 0 0 TCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTT %&&((((&)+++++)+++++++++++++++)+++++++)+++++++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:1316:12923:36151 16 chrM 3 255 50M * 0 0 NCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTT ++))##(&%$"$(")&)))(&')(++++'+($***((&&&$$$ XA:i:1 MD:Z:0T49 RG:Z:01 NH:i:1 NM:i:1
HWI-ST1022:116:DOWWVACXX:3:2111:11212:55994 1040 chrM 3 255 50M * 0 0 NCACAGGTCTATCCCCCTATTAACCACTCACGGGAGCTCTCCATGCATTT !!!$$"#!%""$"!&"#&$"&!!$"!!!"!$"&$#+&&&&&&&#&&&""$ XA:i:2 MD:Z:0T12A36 RG:Z:01 NH:i:1 NM:i:2
HWI-ST1022:116:DOWWVACXX:3:2209:10891:97620 1040 chrM 3 255 50M * 0 0 NCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTT ((&+)))')+)')%+++)+&''$)'%
))(+++++&&)(('%($$& XA:i:1 MD:Z:0T49 RG:Z:01 NH:i:1 NM:i:1
HWI-ST1022:116:DOWWVACXX:3:2305:3258:32943 1040 chrM 3 255 50M * 0 0 NCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTT ))++++++++($++++++)+)
%+++++++++++)(((((&&& XA:i:1 MD:Z:0T49 RG:Z:01 NH:i:1 NM:i:1
HWI-ST1022:116:DOWWVACXX:3:2315:16938:63698 1040 chrM 3 255 50M * 0 0 NCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTT $(%#%)&&((%$!!)&&'+&&"!&%&")))*'(&$((&(&%'&&"$$ XA:i:1 MD:Z:0T49 RG:Z:01 NH:i:1 NM:i:1
HWI-ST1022:116:DOWWVACXX:3:1105:19029:72016 0 chrM 4 255 50M * 0 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTG %&&(((&&*(
++++&++))+++)+)++++++++++++(++++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:1108:12643:56066 1024 chrM 4 255 50M * 0 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTG &&&((('(***(
++++++++++)++'+++%+#)%)+&)&)))++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0
HWI-ST1022:116:DOWWVACXX:3:1112:5270:25498 1024 chrM 4 255 50M * 0 0 CACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTG $$$&&&%%%&(&
)))++++++#))))+++)++#)(***))+)+++ XA:i:0 MD:Z:50 RG:Z:01 NH:i:1 NM:i:0

Any help in this regard will be greatly appreciated.

Thanks,
RK

Answers

  • ebanksebanks Broad InstituteMember, Broadie, Dev ✭✭✭✭

    It looks like the problem lies with the aligner which gave all the reads mapping quality 255 (undefined). The problem with MQ=255 reads has been discussed in other threads so I won't discuss it here. Are you using TOP-HAT? I've been told that this may have been fixed in the most recent version (but if not then you'll need to use a different aligner).

Sign In or Register to comment.