Heads up:
We’re moving the GATK website, docs and forum to a new platform. Read the full story and breakdown of key changes on this blog.
Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.
Attention:
We will be out of the office for a Broad Institute event from Dec 10th to Dec 11th 2019. We will be back to monitor the GATK forum on Dec 12th 2019. In the meantime we encourage you to help out other community members with their queries.
Thank you for your patience!

SortSam is failing due to Error Parsing SAM file: ("Tag of type i should have signed decimal value")

claudiadastclaudiadast Member
edited August 2018 in Ask the GATK team

I am attempting doing variant-calling on a genomic sample, however it failed at the SortSam step due to the following:

Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing text SAM file. Tag of type i should have signed decimal value; File HBCC-DNA-CER-13309.sam; Line 124767604

Line: E00218:353:HC32YALXX:5:2212:7395:55227    83  chr20   27310902    0   151M    =   27310664    -389    GAGCGCTTTCAGGACGACGGTGAAAATGGAAATATCTTCCAAGAAAATCTGGATAGAAGCAATGTCAGAAACTTTTCTGTGATGGATCTACTCAGCTAACAGAGTTGAACCTTTCTTTTGAGAGAGCAGTTTTGCAACACTCTTTTTGTGG ?=<7>@@@[email protected]>>>9>>9>>>>???>>>6??>?=>??>>>??>???>>>>===>>=>>==>=====>=>>=>>>>=>==========>>=>==>=>>>==>=>=>=<>===>>=>=>=<==<=<==<==>=>===>===>=>>>>??=><> NM:i:1  MD:Z:50A100 AS:i

The SAM file was generated using BWA MEM.

I am unfamiliar with this issue. How do I resolve it?

Post edited by claudiadast on

Answers

Sign In or Register to comment.