Test-drive the GATK tools and Best Practices pipelines on Terra

Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

SortSam is failing due to Error Parsing SAM file: ("Tag of type i should have signed decimal value")

claudiadastclaudiadast Member
edited August 2018 in Ask the GATK team

I am attempting doing variant-calling on a genomic sample, however it failed at the SortSam step due to the following:

Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing text SAM file. Tag of type i should have signed decimal value; File HBCC-DNA-CER-13309.sam; Line 124767604

Line: E00218:353:HC32YALXX:5:2212:7395:55227    83  chr20   27310902    0   151M    =   27310664    -389    GAGCGCTTTCAGGACGACGGTGAAAATGGAAATATCTTCCAAGAAAATCTGGATAGAAGCAATGTCAGAAACTTTTCTGTGATGGATCTACTCAGCTAACAGAGTTGAACCTTTCTTTTGAGAGAGCAGTTTTGCAACACTCTTTTTGTGG ?=<7>@@@[email protected]>>>9>>9>>>>???>>>6??>?=>??>>>??>???>>>>===>>=>>==>=====>=>>=>>>>=>==========>>=>==>=>>>==>=>=>=<>===>>=>=>=<==<=<==<==>=>===>===>=>>>>??=><> NM:i:1  MD:Z:50A100 AS:i

The SAM file was generated using BWA MEM.

I am unfamiliar with this issue. How do I resolve it?

Post edited by claudiadast on


Sign In or Register to comment.