Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Could you help me with this GenomeSTRIP error message?

INFO 13:25:42,533 29-Aug-2018 SVDiscovery - Locus search window: 16:1-500000
Caught exception while processing read: E00322:200:HK5JVALXX:5:1204:17827:193291 63 16 59894 0 148M2S = 59997 249 AACCCTAACCCTAACC CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCGA AAFFFJJJJJJJJJJJJJJJJJJJ JJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJFJJJJJFJFJJJ7JFJJFFJFJJJ-AFJFJ7JA7A<AJ<AJJ7AAF JFFJAJA--A<AJF-<FFFF-FA-<7---77F-7-AA-----7F-- BC:Z:none RG:Z:4 NM:i:112 SM:i:0 AS:i:0

ERROR --
ERROR stack trace

java.lang.RuntimeException: Error processing input from 51-08665_S1.bam: null
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runTravers al(DeletionDiscoveryAlgorithm.java:160)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVD iscoveryWalker.java:105)
at org.broadinstitute.sv.discovery.SVDiscoveryWalker.onTraversalDone(SVD iscoveryWalker.java:40)
at org.broadinstitute.gatk.engine.executive.Accumulator$StandardAccumula tor.finishTraversal(Accumulator.java:129)
at org.broadinstitute.gatk.engine.executive.LinearMicroScheduler.execute (LinearMicroScheduler.java:115)
at org.broadinstitute.gatk.engine.GenomeAnalysisEngine.execute(GenomeAna lysisEngine.java:316)
at org.broadinstitute.gatk.engine.CommandLineExecutable.execute(CommandL ineExecutable.java:123)
at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:1 41)
at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(Co mmandLineProgram.java:256)
at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(Co mmandLineProgram.java:158)
at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:91)
at org.broadinstitute.sv.main.SVDiscovery.main(SVDiscovery.java:21)
Caused by: java.lang.NullPointerException
at org.broadinstitute.sv.metadata.isize.InsertRadiusMap.init(InsertRadiu sMap.java:52)
at org.broadinstitute.sv.metadata.isize.InsertRadiusMap.(InsertRad iusMap.java:35)
at org.broadinstitute.sv.discovery.ReadPairInsertSizeSelector.initMinimu mRadiusMap(ReadPairInsertSizeSelector.java:102)
at org.broadinstitute.sv.discovery.ReadPairInsertSizeSelector.getMinimum InsertSize(ReadPairInsertSizeSelector.java:86)
at org.broadinstitute.sv.discovery.ReadPairInsertSizeSelector.selectRead PairRecord(ReadPairInsertSizeSelector.java:62)
at org.broadinstitute.sv.discovery.ReadPairRecordSelector.selectReadPair Record(ReadPairRecordSelector.java:107)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.processRea d(DeletionDiscoveryAlgorithm.java:173)
at org.broadinstitute.sv.discovery.DeletionDiscoveryAlgorithm.runTravers al(DeletionDiscoveryAlgorithm.java:152)
... 11 more

ERROR -------------------------------------------------------------------- ----------------------
ERROR A GATK RUNTIME ERROR has occurred (version 3.7.GS-r1748-0-g74bfe0b):
ERROR
ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
ERROR If not, please post the error message, with stack trace, to the GATK forum.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions https://software.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: Error processing input from 51-08665_S1.bam: null
ERROR -------------------------------------------------------------------- ----------------------

Answers

  • SheilaSheila Broad InstituteMember, Broadie, Moderator admin

    @Gouveia
    Hi,

    I just moved this to the GenomeSTRiP section where @bhandsaker can help you.

    -Sheila

  • bhandsakerbhandsaker Member, Broadie, Moderator admin

    You need to report the version and the command line you are using. Also, I presume you at least skimmed through the documentation and that preprocessing ran successfully.

  • Hi @bhandsaker , I was following several previous suggestions from you. I have tried to reheader (to avoid library related erros), resort ... the .bam files and the SVPreprocess and the SVDiscovery worked now using one of my samples. However, when I included another 9 samples this error came out:

    "Read coordinate 16:223400 precedes earliest allowed read coordinate 16:224001 - input bam files are out of order?"

    Obs: I analyzing a specific region from the chr16.

    I read you suggested in other forum that it could be problem with the aligner software and suggested to use bwa. But here I'm using BWA. Do you know what could I do because I would like to run with 700 samples, then I would like to apply this correction for all samples.

    Thanks so much for your attention!
    Mateus

  • bhandsakerbhandsaker Member, Broadie, Moderator admin

    Please post the entire error message (with stack trace).

  • GouveiaGouveia Member
    edited September 2018

    Hi @bhandsaker, follow all the 3 similar errors:

    **_First error: ****

    ERROR 13:44:19,030 FunctionEdge - Contents of /gpfs/gsfs11/users/gouveiamh/alpha_tall_project/genomestrip/Test_1/logDir/SVPreprocess-44.out:
    INFO 13:44:02,924 HelpFormatter - -----------------------------------------------------------------------------------------
    INFO 13:44:02,926 HelpFormatter - The Genome Analysis Toolkit (GATK) v3.7.GS-r1748-0-g74bfe0b, Compiled 2018/04/10 10:30:23
    INFO 13:44:02,926 HelpFormatter - Copyright (c) 2010-2016 The Broad Institute
    INFO 13:44:02,927 HelpFormatter - For support and documentation go to https://software.broadinstitute.org/gatk
    INFO 13:44:02,927 HelpFormatter - [Tue Sep 18 13:44:02 EDT 2018] Executing on Linux 3.10.0-693.2.2.el7.x86_64 amd64
    INFO 13:44:02,927 HelpFormatter - OpenJDK 64-Bit Server VM 1.8.0_144-b01
    INFO 13:44:02,932 HelpFormatter - Program Args: -T ComputeMetadataWalker -R /data/gouveiamh/alpha_tall_project/genomestrip/reference_metadata/1000G_phase1/human_g1k_v37.fasta -disableGATKTraversal true -md ./output_metadata -computeGCProfiles true -computeReadCounts true -depthFile ./output_metadata/depth/51-07525_S1.depth.txt -spanFile ./output_metadata/spans/51-07525_S1.spans.txt -gcProfileFile ./output_metadata/gcprofile/51-07525_S1.bam.gcprof.zip -readCountFile ./output_metadata/rccache/51-07525_S1.rc.bin -configFile /usr/local/apps/genomestrip/2.00.1833/conf/genstrip_parameters.txt -ploidyMapFile /data/gouveiamh/alpha_tall_project/genomestrip/reference_metadata/1000G_phase1/human_g1k_v37.ploidymap.txt -genomeMaskFile /data/gouveiamh/alpha_tall_project/genomestrip/reference_metadata/1000G_phase1/human_g1k_v37.svmask.fasta -copyNumberMaskFile /data/gouveiamh/alpha_tall_project/genomestrip/reference_metadata/1000G_phase1/human_g1k_v37.gcmask.fasta -readDepthMaskFile /data/gouveiamh/alpha_tall_project/genomestrip/reference_metadata/1000G_phase1/human_g1k_v37.rdmask.bed -genomeInterval 16:1-500000 -minMapQ 10 -maxInsertSizeStandardDeviations 3 -insertSizeRadius 10.0 -referenceProfile ./output_metadata/gcprofile/reference.gcprof.zip
    INFO 13:44:02,938 HelpFormatter - Executing as [email protected] on Linux 3.10.0-693.2.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_144-b01.
    INFO 13:44:02,938 HelpFormatter - Date/Time: 2018/09/18 13:44:02
    INFO 13:44:02,939 HelpFormatter - -----------------------------------------------------------------------------------------
    INFO 13:44:02,939 HelpFormatter - -----------------------------------------------------------------------------------------
    INFO 13:44:02,953 18-Sep-2018 GenomeAnalysisEngine - Strictness is SILENT
    INFO 13:44:03,262 18-Sep-2018 GenomeAnalysisEngine - Downsampling Settings: No downsampling
    INFO 13:44:03,372 18-Sep-2018 GenomeAnalysisEngine - Preparing for traversal
    INFO 13:44:03,399 18-Sep-2018 GenomeAnalysisEngine - Done preparing for traversal
    INFO 13:44:03,399 18-Sep-2018 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING]
    INFO 13:44:03,399 18-Sep-2018 ProgressMeter - | processed | time | per 1M | | total | remaining
    INFO 13:44:03,400 18-Sep-2018 ProgressMeter - Location | reads | elapsed | reads | completed | runtime | runtime
    INFO 13:44:03,407 18-Sep-2018 MetaData - Opening metadata ...
    INFO 13:44:03,407 18-Sep-2018 MetaData - Adding metadata location ./output_metadata ...
    INFO 13:44:03,410 18-Sep-2018 MetaData - Opened metadata.
    INFO 13:44:03,445 18-Sep-2018 MetaData - Loading insert size distributions ...
    INFO 13:44:03,459 18-Sep-2018 ComputeReadDepthCoverageWalker - Using genome mask /data/gouveiamh/alpha_tall_project/genomestrip/reference_metadata/1000G_phase1/human_g1k_v37.svmask.fasta
    INFO 13:44:03,463 18-Sep-2018 MetaData - Loading insert size distributions ...
    INFO 13:44:03,465 18-Sep-2018 ComputeGCProfileWalker - Opening genome mask ...
    INFO 13:44:03,465 18-Sep-2018 ComputeGCProfileWalker - Opened genome mask.
    INFO 13:44:03,466 18-Sep-2018 ComputeGCProfileWalker - Opening copy number mask ...
    INFO 13:44:03,466 18-Sep-2018 ComputeGCProfileWalker - Opened copy number mask.
    INFO 13:44:03,466 18-Sep-2018 ComputeGCProfileWalker - Initializing algorithm ...
    INFO 13:44:03,466 18-Sep-2018 MetaData - Loading insert size distributions ...
    INFO 13:44:03,470 18-Sep-2018 ComputeGCProfileWalker - Algorithm initialized.
    INFO 13:44:03,471 18-Sep-2018 ComputeGCProfileWalker - Opening reference GC profile ...
    INFO 13:44:03,475 18-Sep-2018 ComputeGCProfileWalker - Opened reference GC profile.
    INFO 13:44:03,475 18-Sep-2018 MetaData - Loading insert size distributions ...

    ERROR --
    ERROR stack trace

    java.lang.RuntimeException: RCCache: Read coordinate 16:220421 precedes earliest allowed read coordinate 16:221001 - input bam files are out of order?
    at org.broadinstitute.sv.metadata.depth.ReadCountFileWriter.getCacheWindow(ReadCountFileWriter.java:366)
    at org.broadinstitute.sv.metadata.depth.ReadCountFileWriter.addReadCount(ReadCountFileWriter.java:113)
    at org.broadinstitute.sv.metadata.depth.ComputeReadCountsWalker.processRead(ComputeReadCountsWalker.java:126)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.processRead(ComputeMetadataWalker.java:218)
    at org.broadinstitute.sv.util.gatk.SVBaseReadWalker.simulateTraversal(SVBaseReadWalker.java:234)
    at org.broadinstitute.sv.util.gatk.SVBaseReadWalker.onTraversalDone(SVBaseReadWalker.java:189)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.onTraversalDone(ComputeMetadataWalker.java:208)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.onTraversalDone(ComputeMetadataWalker.java:66)
    at org.broadinstitute.gatk.engine.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
    at org.broadinstitute.gatk.engine.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:115)
    at org.broadinstitute.gatk.engine.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:316)
    at org.broadinstitute.gatk.engine.CommandLineExecutable.execute(CommandLineExecutable.java:123)
    at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:141)
    at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:256)
    at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:158)
    at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:91)
    at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:65)

    ERROR ------------------------------------------------------------------------------------------
    ERROR A GATK RUNTIME ERROR has occurred (version 3.7.GS-r1748-0-g74bfe0b):
    ERROR
    ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
    ERROR If not, please post the error message, with stack trace, to the GATK forum.
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions https://software.broadinstitute.org/gatk
    ERROR
    ERROR MESSAGE: RCCache: Read coordinate 16:220421 precedes earliest allowed read coordinate 16:221001 - input bam files are out of order?
    ERROR -

    Second

    ERROR --
    ERROR stack trace

    java.lang.RuntimeException: RCCache: Read coordinate 16:223400 precedes earliest allowed read coordinate 16:224001 - input bam files are out of order?
    at org.broadinstitute.sv.metadata.depth.ReadCountFileWriter.getCacheWindow(ReadCountFileWriter.java:366)
    at org.broadinstitute.sv.metadata.depth.ReadCountFileWriter.addReadCount(ReadCountFileWriter.java:113)
    at org.broadinstitute.sv.metadata.depth.ComputeReadCountsWalker.processRead(ComputeReadCountsWalker.java:126)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.processRead(ComputeMetadataWalker.java:218)
    at org.broadinstitute.sv.util.gatk.SVBaseReadWalker.simulateTraversal(SVBaseReadWalker.java:234)
    at org.broadinstitute.sv.util.gatk.SVBaseReadWalker.onTraversalDone(SVBaseReadWalker.java:189)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.onTraversalDone(ComputeMetadataWalker.java:208)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.onTraversalDone(ComputeMetadataWalker.java:66)
    at org.broadinstitute.gatk.engine.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
    at org.broadinstitute.gatk.engine.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:115)
    at org.broadinstitute.gatk.engine.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:316)
    at org.broadinstitute.gatk.engine.CommandLineExecutable.execute(CommandLineExecutable.java:123)
    at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:141)
    at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:256)
    at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:158)
    at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:91)
    at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:65)

    ERROR ------------------------------------------------------------------------------------------
    ERROR A GATK RUNTIME ERROR has occurred (version 3.7.GS-r1748-0-g74bfe0b):
    ERROR
    ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
    ERROR If not, please post the error message, with stack trace, to the GATK forum.
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions https://software.broadinstitute.org/gatk
    ERROR
    ERROR MESSAGE: RCCache: Read coordinate 16:223400 precedes earliest allowed read coordinate 16:224001 - input bam files are out of order?
    ERROR

    Third

    ERROR --
    ERROR stack trace

    java.lang.RuntimeException: RCCache: Read coordinate 16:296437 precedes earliest allowed read coordinate 16:297001 - input bam files are out of order?
    at org.broadinstitute.sv.metadata.depth.ReadCountFileWriter.getCacheWindow(ReadCountFileWriter.java:366)
    at org.broadinstitute.sv.metadata.depth.ReadCountFileWriter.addReadCount(ReadCountFileWriter.java:113)
    at org.broadinstitute.sv.metadata.depth.ComputeReadCountsWalker.processRead(ComputeReadCountsWalker.java:126)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.processRead(ComputeMetadataWalker.java:218)
    at org.broadinstitute.sv.util.gatk.SVBaseReadWalker.simulateTraversal(SVBaseReadWalker.java:234)
    at org.broadinstitute.sv.util.gatk.SVBaseReadWalker.onTraversalDone(SVBaseReadWalker.java:189)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.onTraversalDone(ComputeMetadataWalker.java:208)
    at org.broadinstitute.sv.metadata.ComputeMetadataWalker.onTraversalDone(ComputeMetadataWalker.java:66)
    at org.broadinstitute.gatk.engine.executive.Accumulator$StandardAccumulator.finishTraversal(Accumulator.java:129)
    at org.broadinstitute.gatk.engine.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:115)
    at org.broadinstitute.gatk.engine.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:316)
    at org.broadinstitute.gatk.engine.CommandLineExecutable.execute(CommandLineExecutable.java:123)
    at org.broadinstitute.sv.main.SVCommandLine.execute(SVCommandLine.java:141)
    at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:256)
    at org.broadinstitute.gatk.utils.commandline.CommandLineProgram.start(CommandLineProgram.java:158)
    at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:91)
    at org.broadinstitute.sv.main.SVCommandLine.main(SVCommandLine.java:65)

    ERROR ------------------------------------------------------------------------------------------
    ERROR A GATK RUNTIME ERROR has occurred (version 3.7.GS-r1748-0-g74bfe0b):
    ERROR
    ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
    ERROR If not, please post the error message, with stack trace, to the GATK forum.
    ERROR Visit our website and forum for extensive documentation and answers to
    ERROR commonly asked questions https://software.broadinstitute.org/gatk
    ERROR
    ERROR MESSAGE: RCCache: Read coordinate 16:296437 precedes earliest allowed read coordinate 16:297001 - input bam files are out of order?
    ERROR

    Thanks again!!!

  • bhandsakerbhandsaker Member, Broadie, Moderator admin

    I assume you are not using very long reads (e.g. > 1kb) - is that right?
    If not, then you should check how the alignments are being represented in one of the problem bam files in the region being reported. The coordinates being reported in the error message are the mean of (alignment start, alignment end) against the reference. This makes it a bit difficult to determine which record or records are causing the problem, but you could compute mean(start,end) over all reads in this region and let me know the maximum "backwards" jump in this value.
    Alternatively, if you can provide me a sample bam file that exhibits the problem I can take a look.

  • Hi @bhandsaker, Is it possible to send you by email?

    Thanks so much for you help!

Sign In or Register to comment.