Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We encourage our fourm members to be more involved, jump in and help out your fellow researchers with their questions. GATK forum is a community forum and helping each other with using GATK tools and research is the cornerstone of our success as a genomics research community.We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.
Attention:
We will be out of the office on November 11th and 13th 2019, due to the U.S. holiday(Veteran's day) and due to a team event(Nov 13th). We will return to monitoring the GATK forum on November 12th and 14th respectively. Thank you for your patience.

gatk4 vs gatk3

I'm trying to migrate my pipelines that use gatk tools from gatk3 to gatk4 and encounter some problems. Other than differences among syntaxes and options, some tools available in gatk3 are not valid any more in gatk4. For example, I got a 'RealignerTargetCreator' is not a valid command error. I'm wondering if this could be due to one of two things: either a tool is no longer available at all or the tool may have a different name (or a replacement) in gatk4. So my question is, is there a document listing tools that are totally new in gatk4, removed from gatk4, or have different names (or there're equivalent tools) in gatk4? Thanks.

Answers

  • SheilaSheila Broad InstituteMember, Broadie admin

    @spz1st
    Hi,

    Here is the tool documentation for all tools in GATK4.

    Have a look at this blog post for reasons why the Indel Realignment step is not included in GATK4.

    -Sheila

  • Is there a migration guide from ver 3 --> 4 ? the launch page says such guide will be published, but I could not locate it..

    Thanks

  • @Sheila perhaps you have an know where I can find such a migration guide?

  • SheilaSheila Broad InstituteMember, Broadie admin

    @rgranit

    Hi,

    Sorry for the delay. You can switch between the GATK3 and GATK4 docs by going to the user guide and clicking on an option (Tool documentation etc). Then, at the top of the page, you will see an orange bar with GATK4. If you click on that bar, you will see a dropdown with an option to "Switch to GATK3 docs"

    I hope this helps.

    -Sheila
    P.S. After writing that, I realized you are looking for an actual guide article. Sorry, but I don't think that exists.

  • @Sheila , what are the major differences in GATK3 and GATK4 in tools used in Whole genome analyses (Base Recalibration, HaplotypeCaller, etc.) regarding the quality of outputs. Is it the same, almost the same or one or the other is better?

  • bhanuGandhambhanuGandham Cambridge MAMember, Administrator, Broadie, Moderator admin

    Hi @Vladimir_Kovacevic

    The main differences are in speed, scalability and edge cases (low quality or low coverage areas).
    Here is thread explaining differences in BQSR from gatk3 to gatk4.
    here is another link with more info between the differences.

    Hope this helps.

    Regards
    Bhanu

  • NeginNegin Member

    Dear GATK team,
    I have used gatk4 for all steps of my process including variant calling, Joint genotyping, and hard filtering, but after that I want to use gatk3.8 with SnpEff for variant annotation. Is it fine?
    Are gatk4 and gatk3.8 compatible?

    Thanks in advance,
    Negin

  • AdelaideRAdelaideR Member admin

    GATK4 will not call the variants in the same way and may filter out many of the threshold variants that are accepted by GATK3. There is ample information in the Forum and in our Release notes in how this differs.

    If you are looking for an annotation tool, have you considered Functotator?

  • NeginNegin Member

    Thanks @AdelaideR,

    Actually I am working on bacteria and I don’t know if I can apply Functotator for bacteria because maybe no related database is available for bacteria! Can I apply it also for bacteria?
    Second, I am interested in SNP-effect (Synonymous, Non-synonymous, ...) and amino-acid changes, but I couldn’t find these annotations among the annotations of Functotator that’s why I want to apply SnpEff with GATK 3, although all the previous steps till hard-filtering was done by GATk 4.

    What do you suggest?

    Thanks again,
    Negin

  • AlFatlawiAlFatlawi Member
    Hi @AdelaideR

    But what is the relationship between the filtering and annotation?
    If already filtered them with GATK 4 and then selected the non-filter variants, then as in the last step, I used GATK3.8 with Snpeff for functional annotation?

    Another issue please,
    The reason that why I need to use Sneff although I already applied Functotator, is that Functotator doesn't give some important information like the amino-acid change, or the impact of variants whether it is a synonym, miss-sense, none-sense ..etc.
    it gives only the following:
    FUNCOTATION=[Unknown|hg38|1|135195|135195|IGR||SNP|A|A|G|g.1:135195A>G|no_transcript|||||||0.6533665835411472|GGGCCCGTGCAGGCCTTCGAG||||||||||||||||||||||||||
    ||||false||];InbreedingCoeff=0.0665;MLEAC=1;MLEAF=3.125e-03;MQ=60.00;QD=12.16;SNPEFF_CODON_CHANGE=1629;

    On the other side, the snpeff will gives: SNPEFF_EFFECT=UPSTREAM;SNPEFF_FUNCTIONAL_CLASS=NONE;SNPEFF_GENE_BIOTYPE=lincRNA;SNPEFF_GENE_NAME=RP11-34P13.7;SNPEFF_IMPACT=MODIFIER;SNPEFF_TRANSCRIPT_ID=ENST00000453576
    ;SOR=2.833

    Please, could you help with this?
    Regards
Sign In or Register to comment.