To celebrate the release of GATK 4.0, we are giving away free credits for running the GATK4 Best Practices pipelines in FireCloud, our secure online analysis portal. It’s first come first serve, so sign up now to claim your free credits worth $250. Sponsored by Google Cloud. Learn more at

A GATK RUNTIME ERROR, Invalid alignment found, alignmentStart > alignemntEnd

Hi, I was in the second step of Genome STRiP, to discover SV. It seems that all "partition" jobs worked fine, except one. The error message looks like this:

ERROR 00:12:01,906 FunctionEdge - Contents of /u/flashscratch/h/hjzhou/biploar_del_discovery_out/deletions100k/logs/SVDiscovery-203.out:
##### ERROR stack trace
java.lang.RuntimeException: Invalid alignment found, alignmentStart (1231809) > alignemntEnd (1231808) HS2000-887_377:1:1112:13543:35396        81      chr12   1231809 70      62I38S  =       1230685 -1124   ATCTCTATCTCTATCTCTATCTGTGCCTATTGATATATCTGTATATATCTATCTAAATCTCTATCTCTATCTCTATCTGTGCCTATTGATATATCTGTAT    CA@>EFECFEDBEAHHHIIIHEHGHGIIJIIGIIGIGJJCJJIGFCJIJJIJJIIIHDEGHGIEJGHHHEHGIJIHJJIJJIJJJIJHGHHHFDFFFC@C    SA:Z:chr12,1231809,-,56S44M,60,1;       MC:Z:100M       OC:Z:62M38S     RG:Z:LP6005646-DNA_B05  NM:i:62 MQ:i:60 AS:i:57 XS:i:25

I am very new to Genome STRiP and GATK. Any clue or advice would be helpful.

Best Answer


  • SheilaSheila Broad InstituteMember, Broadie, Moderator


    I just moved your question to GenomeSTRiP section where @bhandsaker can help you.


  • Thank you @Sheila. I wasn't ware that I posted in the wrong section.

  • Thank you very much @bhandsaker !

Sign In or Register to comment.