A GATK RUNTIME ERROR, Invalid alignment found, alignmentStart > alignemntEnd

Hi, I was in the second step of Genome STRiP, to discover SV. It seems that all "partition" jobs worked fine, except one. The error message looks like this:

ERROR 00:12:01,906 FunctionEdge - Contents of /u/flashscratch/h/hjzhou/biploar_del_discovery_out/deletions100k/logs/SVDiscovery-203.out:
##### ERROR stack trace
java.lang.RuntimeException: Invalid alignment found, alignmentStart (1231809) > alignemntEnd (1231808) HS2000-887_377:1:1112:13543:35396        81      chr12   1231809 70      62I38S  =       1230685 -1124   ATCTCTATCTCTATCTCTATCTGTGCCTATTGATATATCTGTATATATCTATCTAAATCTCTATCTCTATCTCTATCTGTGCCTATTGATATATCTGTAT    CA@>EFECFEDBEAHHHIIIHEHGHGIIJIIGIIGIGJJCJJIGFCJIJJIJJIIIHDEGHGIEJGHHHEHGIJIHJJIJJIJJJIJHGHHHFDFFFC@C    SA:Z:chr12,1231809,-,56S44M,60,1;       MC:Z:100M       OC:Z:62M38S     RG:Z:LP6005646-DNA_B05  NM:i:62 MQ:i:60 AS:i:57 XS:i:25

I am very new to Genome STRiP and GATK. Any clue or advice would be helpful.

Best Answer


  • SheilaSheila Broad InstituteMember, Broadie, Moderator


    I just moved your question to GenomeSTRiP section where @bhandsaker can help you.


  • Thank you @Sheila. I wasn't ware that I posted in the wrong section.

  • Thank you very much @bhandsaker !

Sign In or Register to comment.