CalculateMixingFractions Returns all NaN?

Hi there, I'm attempting to use the CalculateMixingFractions tool to estimate the mixture of genomes from a VCF in a pooled BAM file and getting all NaN as output.

The output looks like this:

SAMPLE MIXING_FRACTION GENO1 NaN GENO2 NaN GENO3 NaN etc...

And the headers of my VCF file is the following:

##fileformat=VCFv4.1 ##filedate=2017.8.8 ##source=Minimac3 ##FORMAT= ##FORMAT= ##FORMAT= ##INFO= ##INFO= ##INFO= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT GENO1 GENO2 GENO3 chr10 67193 rs1111111:67193:C:T C T . . . GT:AS 0|0:0,0 0|0:0,0 0|0:4,0

And the header for the SAM file is:

@HD VN:1.4 SO:coordinate SQ SN:chr1 LN:249250621 SQ SN:chr2 LN:243199373 ...etc SL-HEL:C66HBACXX150512:C66HBACXX:6:1302:18557:85138 147 chr1 10000 0 25M = 10003 -22 ATAACCCTAACCCTAACCCTAACCC ##BA39A<@CBBCCBBBAAAA<;==> MD:Z:25 PG:Z:MarkDuplicates NM:i:0 AS:i:25 XS:i:25 etc...

Answers

  • SheilaSheila Broad InstituteMember, Broadie, Moderator

    @mtvector
    Hi,

    I will ask the developer to respond. Note, it has been deprecated in the major release, so any bugs most likely will not be fixed.

    -Sheila

  • Thanks Sheila, I don't see where it's deprecated, but I look forward to a response!

  • SheilaSheila Broad InstituteMember, Broadie, Moderator
    edited February 14

    @mtvector
    Hi,

    From the developer:

    The tool gets its signal from biallelic singleton hets, and it determines singleton hets from variant contexts with an AC of 1 (i.e. the alt allele appears on exactly one chromosome). Your VCF doesn't have an AC field which is why you are having the issue. It's true that this could easily be determined from the GT fields, but this tool is intended only for internal use in our Mutect2 validations.

    I made a mistake saying the tool is deprecated. It is not, but it is meant for internal use and not really supported.

    -Sheila

Sign In or Register to comment.