Notice:
If you happen to see a question you know the answer to, please do chime in and help your fellow community members. We appreciate your help!

Test-drive the GATK tools and Best Practices pipelines on Terra


Check out this blog post to learn how you can get started with GATK and try out the pipelines in preconfigured workspaces (with a user-friendly interface!) without having to install anything.

Why do I see variant calls by haplotype caller with zero reads supporting the alternate allele?

The example variant call is shown below,
13 28608228 . A AATTTTCTCTTGGAAACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGCTCAC 2040.73 . AC=1;AF=0.500;AN=2;DP=867;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=70.00;QD=2.35;SOR=0.105 GT:AD:GQ:PL:SAC 0/1:2,0:99:2078,0,836:0,2,0,0

I understand that haplotype caller uses certain filters. Technically this variant should not have been called if the reads remaining after applying filters is zero.

Answers

Sign In or Register to comment.