We've moved!
This site is now read-only. You can find our new documentation site and support forum for posting questions here.
Be sure to read our welcome blog!

Why do I see variant calls by haplotype caller with zero reads supporting the alternate allele?

The example variant call is shown below,
13 28608228 . A AATTTTCTCTTGGAAACTCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGCTCAC 2040.73 . AC=1;AF=0.500;AN=2;DP=867;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=70.00;QD=2.35;SOR=0.105 GT:AD:GQ:PL:SAC 0/1:2,0:99:2078,0,836:0,2,0,0

I understand that haplotype caller uses certain filters. Technically this variant should not have been called if the reads remaining after applying filters is zero.

Answers

Sign In or Register to comment.