The current GATK version is 3.7-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Did you remember to?


1. Search using the upper-right search box, e.g. using the error message.
2. Try the latest version of tools.
3. Include tool and Java versions.
4. Tell us whether you are following GATK Best Practices.
5. Include relevant details, e.g. platform, DNA- or RNA-Seq, WES (+capture kit) or WGS (PCR-free or PCR+), paired- or single-end, read length, expected average coverage, somatic data, etc.
6. For tool errors, include the error stacktrace as well as the exact command.
7. For format issues, include the result of running ValidateSamFile for BAMs or ValidateVariants for VCFs.
8. For weird results, include an illustrative example, e.g. attach IGV screenshots according to Article#5484.
9. For a seeming variant that is uncalled, include results of following Article#1235.

Did we ask for a bug report?


Then follow instructions in Article#1894.

Formatting tip!


Surround blocks of code, error messages and BAM/VCF snippets--especially content with hashes (#)--with lines with three backticks ( ``` ) each to make a code block.
Powered by Vanilla. Made with Bootstrap.
Picard 2.9.0 is now available. Download and read release notes here.
GATK 3.7 is here! Be sure to read the Version Highlights and optionally the full Release Notes.

MarkDuplicates---“did not start with a parseable number”

Mozz1AMozz1A USMember Posts: 1

I was running RNA-seq data through the MarkDuplicates in Picard package for SNP calling getting the message:

WARNING 2016-08-31 16:48:12 AbstractOpticalDuplicateFinderCommandLineProgram A field field parsed out of a read name was expected to contain an integer and did not. Read name: SN1001:449:HGTN3ADXX:1:2115:4606:89966:R2#1#CTCCT. Cause: String 'R2#1#CTCCT' did not start with a parsable number.

Then I run the command:

samtools view resources/HepG2.RBFOX2/HepG2.RBFOX2.rep2.R2.tag.uniq.sorted.bam | grep R2#1#CTCCT

And I got this:

SN1001:449:HGTN3ADXX:2:2110:11231:12370:R2#1#CTCCT 16 chrX 133035777 37 31M * 0 0 TTTTTGAGTTAAAGTTATACACCTGAAGAGG BFFBFB

So I tried to run the command ValidateSamFile


ERROR: Record 2243391, Read name SN1001:449:HGTN3ADXX:1:1207:18758:88057:R2#2#TATAT, NM tag (nucleotide differences) in file [2] does not match reality [6]
ERROR: Record 2500598, Read name SN1001:449:HGTN3ADXX:2:1206:6729:26515:R2#1#TAATC, NM tag (nucleotide differences) in file [3] does not match reality [7]
ERROR: Record 2500599, Read name SN1001:449:HGTN3ADXX:2:2110:7481:90889:R2#1#TTCAG, NM tag (nucleotide differences) in file [3] does not match reality [8]
ERROR: Record 2500601, Read name SN1001:449:HGTN3ADXX:1:1210:6384:54132:R2#1#TAGAT, NM tag (nucleotide differences) in file [3] does not match reality [9]
ERROR: Record 2500602, Read name SN1001:449:HGTN3ADXX:2:2111:15383:87620:R2#1#GGGGG, NM tag (nucleotide differences) in file [3] does not match reality [9]
ERROR: Record 2500603, Read name SN1001:449:HGTN3ADXX:2:2212:9564:100522:R2#1#GGCGC, NM tag (nucleotide differences) in file [3] does not match reality [10]
ERROR: Record 2500604, Read name SN1001:449:HGTN3ADXX:1:2110:14050:67425:R2#1#GGCCC, NM tag (nucleotide differences) in file [2] does not match reality [9]
ERROR: Record 2500605, Read name SN1001:449:HGTN3ADXX:1:2205:20926:12488:R2#1#TCCCC, NM tag (nucleotide differences) in file [1] does not match reality [3]
ERROR: Record 2500606, Read name SN1001:449:HGTN3ADXX:2:2109:8561:77192:R2#1#CCCCC, NM tag (nucleotide differences) in file [1] does not match reality [3]

Does this warning message matters?

Sign In or Register to comment.