The current GATK version is 3.7-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Get notifications!


You can opt in to receive email notifications, for example when your questions get answered or when there are new announcements, by following the instructions given here.

Did you remember to?


1. Search using the upper-right search box, e.g. using the error message.
2. Try the latest version of tools.
3. Include tool and Java versions.
4. Tell us whether you are following GATK Best Practices.
5. Include relevant details, e.g. platform, DNA- or RNA-Seq, WES (+capture kit) or WGS (PCR-free or PCR+), paired- or single-end, read length, expected average coverage, somatic data, etc.
6. For tool errors, include the error stacktrace as well as the exact command.
7. For format issues, include the result of running ValidateSamFile for BAMs or ValidateVariants for VCFs.
8. For weird results, include an illustrative example, e.g. attach IGV screenshots according to Article#5484.
9. For a seeming variant that is uncalled, include results of following Article#1235.

Did we ask for a bug report?


Then follow instructions in Article#1894.

Formatting tip!


Wrap blocks of code, error messages and BAM/VCF snippets--especially content with hashes (#)--with lines with three backticks ( ``` ) each to make a code block as demonstrated here.

Jump to another community
Picard 2.9.4 is now available. Download and read release notes here.
GATK 3.7 is here! Be sure to read the Version Highlights and optionally the full Release Notes.

Picard MarkDuplicates string did not start with a parseable number

ryanfriedman22ryanfriedman22 Washington University in St. LouisMember

I'm running RNA-seq data through the GATK Pipeline for RNA-seq variant calling and am getting an AbstractOpticalDuplicateFinderCommandLineProgram Warning while running MarkDuplicates with the message

A field field parsed out of a read name was expected to contain an integer and did not. Read name: C1n.EXACT.TTAT.13482648. Cause: String 'C1n.EXACT.TTAT.13482648' did not start with a parsable number.

I'm not quite sure how this is the case, since when I run the command

samtools view rg_added_sorted.bam | grep C1n.EXACT.TTAT.13482648

the output is:

C1n.EXACT.TTAT.13482648 16 chr1 5196 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:1 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr3 1813 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:3 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr3 9145 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:4 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr4 1347 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:6 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr10 691 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:7 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 256 chr10 1054683 0 32M * 0 0 CCTCTGATGAACTCCAAGCTGTTCATCTCGAA * RG:Z:id NH:i:7 HI:i:2 nM:i:0 AS:i:31
C1n.EXACT.TTAT.13482648 272 chr11 1443 0 32M * 0 0 TTCGAGATGAACAGCTTGGAGTTCATCAGAGG * RG:Z:id NH:i:7 HI:i:5 nM:i:0 AS:i:31

I'm running the following command as a part of a job on a SLURM cluster using JVM build 25.31-b07, mixed mode

java -Xmx8G -Xms8G -jar $PICARD_HOME/picard.jar MarkDuplicates I=rg_added_sorted.bam O=dedupped.bam CREATE_INDEX=true VALIDATION_STRINGENCY=SILENT M=output.metrics

There's no stack trace since it's just a warning, but it causes problems later when I run SplitNCigarReads, saying it's malformed.

Best Answer

Answers

Sign In or Register to comment.