The current GATK version is 3.7-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Did you remember to?

1. Search using the upper-right search box, e.g. using the error message.
2. Try the latest version of tools.
3. Include tool and Java versions.
4. Tell us whether you are following GATK Best Practices.
5. Include relevant details, e.g. platform, DNA- or RNA-Seq, WES (+capture kit) or WGS (PCR-free or PCR+), paired- or single-end, read length, expected average coverage, somatic data, etc.
6. For tool errors, include the error stacktrace as well as the exact command.
7. For format issues, include the result of running ValidateSamFile for BAMs or ValidateVariants for VCFs.
8. For weird results, include an illustrative example, e.g. attach IGV screenshots according to Article#5484.
9. For a seeming variant that is uncalled, include results of following Article#1235.

Did we ask for a bug report?

Then follow instructions in Article#1894.

Formatting tip!

Surround blocks of code, error messages and BAM/VCF snippets--especially content with hashes (#)--with lines with three backticks ( ``` ) each to make a code block.
Powered by Vanilla. Made with Bootstrap.
Picard 2.9.0 is now available. Download and read release notes here.
GATK 3.7 is here! Be sure to read the Version Highlights and optionally the full Release Notes.

Tribble issue: Vcf files with single ended breakpoints fail

LouisBLouisB Broad InstituteMember, Broadie, Dev Posts: 26

I'm running into a problem with vcfs that have single ended break ends. (These are produced by an old version of Strelka .) Tribble doesn't recognize "." as valid in alternative alleles.

Single break ends are valid in the vcf standard and the files validate according to Vcftools.

Others have run into this problem as well:!searchin/strelka-discuss/gatk/strelka-discuss/gJfsyjZNZXA/ExDXZiVWW_kJ

example error

##### ERROR stack trace
org.broad.tribble.TribbleException: The provided VCF file is malformed at approximately line number 1807: Unparsable vcf record with allele .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC, for input source: /cga/tcga-gsc/benchmark/Indels/strelkaPON/NA18606.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam-NA18608.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam/final.indels.vcf
at org.broadinstitute.variant.vcf.AbstractVCFCodec.generateException(
at org.broadinstitute.variant.vcf.AbstractVCFCodec.checkAllele(
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseSingleAltAllele(
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseAlleles(
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseVCFLine(
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decodeLine(
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(
at org.broad.tribble.AsciiFeatureCodec.decode(
at org.broad.tribble.AsciiFeatureCodec.decode(
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.readNextRecord(
at org.broad.tribble.TribbleIndexedFeatureReader$
at org.broad.tribble.TribbleIndexedFeatureReader$
at org.broadinstitute.sting.commandline.CommandLineProgram.start(
at org.broadinstitute.sting.commandline.CommandLineProgram.start(
##### ERROR ------------------------------------------------------------------------------------------

Example vcf line

19  36002413    .   C   .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC    .   PASS    IHP=1;NT=ref;QSI=82;QSI_NT=82;SGT=ref->hom;SOMATIC;SVTYPE=BND;TQSI=1;TQSI_NT=1  DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50   49:49:42,44:0,0:7,6:43.72:0.85:0.00 11:11:0,0:6,6:5,5:14.61:0.48:0.0

A full vcf is available at:

Best Answers


Sign In or Register to comment.