The current GATK version is 3.7-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Powered by Vanilla. Made with Bootstrap.
GATK 3.7 is here! Be sure to read the Version Highlights and optionally the full Release Notes.
Register now for the upcoming GATK Best Practices workshop, Feb 20-22 in Leuven, Belgium. Open to all comers! More info and signup at http://bit.ly/2i4mGxz

Tribble issue: Vcf files with single ended breakpoints fail

LouisBLouisB Broad InstituteMember, Broadie, Dev Posts: 25

I'm running into a problem with vcfs that have single ended break ends. (These are produced by an old version of Strelka .) Tribble doesn't recognize "." as valid in alternative alleles.

Single break ends are valid in the vcf standard and the files validate according to Vcftools.

Others have run into this problem as well:
https://groups.google.com/forum/#!searchin/strelka-discuss/gatk/strelka-discuss/gJfsyjZNZXA/ExDXZiVWW_kJ

example error

##### ERROR stack trace
org.broad.tribble.TribbleException: The provided VCF file is malformed at approximately line number 1807: Unparsable vcf record with allele .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC, for input source: /cga/tcga-gsc/benchmark/Indels/strelkaPON/NA18606.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam-NA18608.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam/final.indels.vcf
at org.broadinstitute.variant.vcf.AbstractVCFCodec.generateException(AbstractVCFCodec.java:715)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.checkAllele(AbstractVCFCodec.java:527)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseSingleAltAllele(AbstractVCFCodec.java:553)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseAlleles(AbstractVCFCodec.java:494)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseVCFLine(AbstractVCFCodec.java:291)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decodeLine(AbstractVCFCodec.java:234)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:213)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:45)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:73)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:35)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.readNextRecord(TribbleIndexedFeatureReader.java:284)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:264)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:225)
at org.broadinstitute.sting.tools.CatVariants.execute(CatVariants.java:239)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sting.tools.CatVariants.main(CatVariants.java:258)
##### ERROR ------------------------------------------------------------------------------------------

Example vcf line

19  36002413    .   C   .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC    .   PASS    IHP=1;NT=ref;QSI=82;QSI_NT=82;SGT=ref->hom;SOMATIC;SVTYPE=BND;TQSI=1;TQSI_NT=1  DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50   49:49:42,44:0,0:7,6:43.72:0.85:0.00 11:11:0,0:6,6:5,5:14.61:0.48:0.0

A full vcf is available at:
/humgen/gsa-scr1/pub/incoming/BreakendBug/breakend.vcf

Best Answers

Answers

Sign In or Register to comment.