The current GATK version is 3.7-0
Examples: Monday, today, last week, Mar 26, 3/26/04

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

Powered by Vanilla. Made with Bootstrap.
GATK 3.7 is here! Be sure to read the Version Highlights and optionally the full Release Notes.
Register now for the upcoming GATK Best Practices workshop, Feb 20-22 in Leuven, Belgium. Open to all comers! More info and signup at

Insertion interpretation

brdidobrdido São Paulo - BrazilMember Posts: 32

Hello again,

we are having trouble trying to understand a insertion called by HaplotypeCaller (HC).

First we can't see any read confirming the insertion in IGV.

Second is that HC is telling us that it has a coverage of 126 reads and only 12 confirming the insertion but it calls as a homozygous insertion. Could you help us to find a direction to understand what is happening please?

Please note that the insertion seq is on the reference genome (b37) and it ends at the start position called by HC.

19 42489516 . A ATGTTCCGAGTCTCCAAGGGGTTGTCGTGC 167.77 . AC=2;AF=1.00;AN=2;DP=126;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;QD=0.05 GT:AD:GQ:PL 1/1:0,12:99:3848,330,0

1948 x 1023 - 90K

Best Answer


Sign In or Register to comment.