Bug Bulletin: The GenomeLocPArser error in SplitNCigarReads has been fixed; if you encounter it, use the latest nightly build.

Tribble issue: Vcf files with single ended breakpoints fail

LouisBLouisB Broad InstitutePosts: 25Member, Third-party Developer, GSA Collaborator, Broadie, Cancer Tools Developer

I'm running into a problem with vcfs that have single ended break ends. (These are produced by an old version of Strelka .) Tribble doesn't recognize "." as valid in alternative alleles.

Single break ends are valid in the vcf standard and the files validate according to Vcftools.

Others have run into this problem as well: https://groups.google.com/forum/#!searchin/strelka-discuss/gatk/strelka-discuss/gJfsyjZNZXA/ExDXZiVWW_kJ

example error

##### ERROR stack trace
org.broad.tribble.TribbleException: The provided VCF file is malformed at approximately line number 1807: Unparsable vcf record with allele .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC, for input source: /cga/tcga-gsc/benchmark/Indels/strelkaPON/NA18606.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam-NA18608.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam/final.indels.vcf
at org.broadinstitute.variant.vcf.AbstractVCFCodec.generateException(AbstractVCFCodec.java:715)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.checkAllele(AbstractVCFCodec.java:527)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseSingleAltAllele(AbstractVCFCodec.java:553)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseAlleles(AbstractVCFCodec.java:494)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseVCFLine(AbstractVCFCodec.java:291)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decodeLine(AbstractVCFCodec.java:234)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:213)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:45)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:73)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:35)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.readNextRecord(TribbleIndexedFeatureReader.java:284)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:264)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:225)
at org.broadinstitute.sting.tools.CatVariants.execute(CatVariants.java:239)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sting.tools.CatVariants.main(CatVariants.java:258)
##### ERROR ------------------------------------------------------------------------------------------

Example vcf line

19  36002413    .   C   .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC    .   PASS    IHP=1;NT=ref;QSI=82;QSI_NT=82;SGT=ref->hom;SOMATIC;SVTYPE=BND;TQSI=1;TQSI_NT=1  DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50   49:49:42,44:0,0:7,6:43.72:0.85:0.00 11:11:0,0:6,6:5,5:14.61:0.48:0.0

A full vcf is available at: /humgen/gsa-scr1/pub/incoming/BreakendBug/breakend.vcf

Best Answers


Sign In or Register to comment.